A. What would be the donor organism to be used in this cloning? B. How would you make sure you only get your gene of interest (EGF) from donor but nothing else? C. How do you put EGF gene into pKY plasmid? What is the best RE to use when inserting the gene into pKY plasmid? What happens if you use the enzyme Bgl I to insert the gene of interest? How does it affect your cloning result? D. How do you make sure you only grow E.coli that have the gene of interest?

A. What would be the donor organism to be used in this cloning? B. How would you make sure you only get your gene of interest (EGF) from donor but nothing else? C. How do you put EGF gene into pKY plasmid? What is the best RE to use when inserting the gene into pKY plasmid? What happens if you use the enzyme Bgl I to insert the gene of interest? How does it affect your cloning result? D. How do you make sure you only grow E.coli that have the gene of interest?

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter18: Dna Technologies: Making And Using Genetically Altered Organisms, And Other Applications

Section: Chapter Questions

Problem 3TYK: Why are antibiotic resistance markers such as ampR important components of bacterial plasmid cloning...

See similar textbooks

Similar questions

Explain the THREE (3) important regions of this plasmid that enable it to work efficiently as a cloning vector?
A.How could endonucleases interfere with the transformation procedure? B. Does supercoiled or nicked plasmid get transformed more efficiently? Why?
a. What is the purpose of molecular cloning?b. What purpose do selectable markers serve in vectors?c. What is the purpose of the origin of replication in aplasmid vector?d. Why do cloning vectors have polylinkers?
Im designing a restriction cloning experiment. My professor said that plasmid and insert DNA work best in a 1:1 ratio. If my reaction does not work the first time I perform it, how would I ensure that the cause was the difference in concentration of reagents and how would I fix it so that the I have the correct concentration? If a restriction cloning experiment does not work, how could I be certain that it was due to an incorrect ratio of plasmid:insert and how can i fix this?
Sal1 Xho1 Insert pUC cloning vector MCS Insert Digested with Sal1 on the left and Xho1 on the right Sal1 Ori Vector Digested with Sal1 Xho1: СТСGAG Sal1: GTCGAC RE cut site Part B) After 8 h of sleep, you realize your mistake above (Question 3 Part A), and you successfully transformed your plasmid and obtained a subset of white colonies and blue colonies on the plate. Question: You conclude that all the blue colonies contain a plasmid O With the insert in the LacZ screening marker With the insert in the Antibiotic selectable marker O Without an insert in the LacZ screening marker O None of the above + Lacz alpha AmpR
You first need to create a plasmid. What are the minimal components necessary to develop this plasmid? In addition to these components, please draw the plasmid. In this illustration, I am looking for the components, the direction of transcription (i.e., the direction the genes will be transcribed), and what should be transcribed last? Also, where would you specifically insert the P. falciparum gene in this plasmid, and why are you checking reading frames in your gene? Finally, please name your plasmid using the correct nomenclature too. You are excited you have this new plasmid; you want to transfect it into P. marinus and provide it as an oral vaccine to laboratory mice. However, even though your supervisor enjoys your enthusiastic attitude, they do not allow you to do this quite yet because all you have is this plasmid. Why doesn’t your supervisor allow you to use the laboratory mouse for this research regarding animal welfare guidelines? Your answer should include the 3 R’s of…
What is an engineered plasmid used for? What are the important features of\ engineered plasmids?
ECOR1 cuts Plasmid T into 3 pieces. Feeling grumpy at your professor (☹), you decide to take a random enzyme and mix it with a random plasmid, Plasmid M (for mystery). You run a gel and see one very large band at the top of the gel. Which of the following is NOT likely: a. Plasmid M has zero restriction sites for any enzyme b. The enzyme and plasmid are not the same as Ecor1 and Plasmid T c. Plasmid M wasn't cut at all d. The plasmid does not have a restriction site for the mystery enzyme Please answer asap and type your answer and do not copy from anywhere please
Why are antibiotic resistance markers such as ampR important components of bacterial plasmid cloning vectors? a. The plasmid must have resistance to accept DNA inserts. b. They allow the detection of plasmids that contain an inserted DNA fragment. c. They ensure the presence of the ori site. d. They ensure that the plasmid can be cut by a restriction enzyme. e. They allow identification of bacteria that have taken up a plasmid.
Please answer this asap. Thanks, You have discovered a new plasmid RK21 in a unique bacterial community. As a first step towardunderstanding this plasmid, you digest the plasmid with three restriction enzymes: SspI, XhoI andSmaI. You run the digested plasmid DNA on an agarose gel, along with an uncut sample of theRK21 plasmid DNA as a control.Unfortunately you forget to load a DNA ladder, and obtain the following results. Assumecomplete digestion of all samples or all the digests worked completely
Primers designing for epitope tagging: Design forward and reverse primers to amplify the following gene with 6×HIS-tag on the N-terminus of the protein. To be cleaved and inserted into the plasmid, add restriction sites for EcoRI and HindIII at 5' and 3'. ATGCTCTCCGCCCTCGCCCGGCCTGTCAGCGCTGCTCTCCGCCGCAGCTTCAGCACCTCAGCC CAGAACAATGCTAAAGTAGCTGTGCTAGGGGCCTCTGGAGGCATCGGGCAGCCACTTTCAC TTCTCCTGAAGAACAGCCCCTTGGTGAGCCGCCTGACCCTCTATGATATCGCGCACACACCC GGAGTGGCCGCAGATCTGAGCCACATCGAGACCAAAGCCGCTGTGAAAGGCTACCTCGGAC CTGAACAGCTGCCTGACTGCCTGAAAGGTTGTGATGTGTAA
. Propose a mechanism by which a type II topoisomerase could use the energy of ATP hydrolysis to scan a large DNA molecule and, thereby, to direct that the enzyme will catalyze largely “disentan- gling" reactions (decatenation and unknotting).