Based on the figure below, what is the number of turnovers in stage B? D 34 24 16 4 Geological stages Youngest fossil of a species Oldest known fossil of a species
Q: Which of the following depicts an epigenetic change? 1. Green, variegated, and albino Agave plants…
A: Epigenetic means the trait which is not inherited but is controlled by surrounding factors. It…
Q: 13.Which is NOT an example of innate defense? 13.Which is NOT an example of innate defense? Note:…
A: Immunity is a phenomenon which helps an organisms to fight against the harmful pathogens so that…
Q: Which among the following is generally considered weakest among Bradford Hill’s guidelines: a.…
A: The following is generally considered weakest among Bradford Hill's guidelines: c. specificity
Q: 18. Which of the following entities has the largest interaction cross-section (most likely to…
A: Tissues are group of cells having similar function and structure.
Q: This condition is characterized by underdevelopment of the brain which can result from insufficient…
A: Introduction :- Spina bifida is a birth defect caused by improper development of the spine and…
Q: 1. Identical twins may show dissimilar phenotypes due to changed methylation patterns of the…
A: Twins are two offspring produced by same mother in same pregnancy. Twins can be identical and non…
Q: 7.How does oxygen and carbon dioxide enter and leave the lung capilliaries respectively? Read and…
A: During the process of respiration the entry and exit of oxygen and carbon dioxide is facilitated by…
Q: Define death in physiological terms. We know that when the human heart stops beating, it can be…
A: The cardiovascular system is a network of arteries and veins in which the heart pumps blood. One of…
Q: Which type of circulation ensures enough oxygenated blood will be supplied to the different parts of…
A: Introduction Circulatory system:- It is the system that contains the heart and the blood vessels and…
Q: the glycolytic enzyme pyruvate kinase is activated by dephosphorylation and inactivated by…
A: Pyruvate kinase It's an important glycolysis enzyme that helps converting PEP (phosphoenolpyruvate)…
Q: Question 12 A student performing a biological specimen studies using cancer cells, wants to check…
A: methyl orange is used as indicator, this value is also known as the m-value. The method is suitable…
Q: 3. The immune system immediately attacks a transplanted tissue or organ, so transplant recipients…
A: Introduction :- Transplant rejection occurs when the immune system of a transplant recipient attacks…
Q: Construct a cladogram based on the following data. Mosses are plants with no vascular tissue.…
A: Land plants can be referred to as multicellular creatures that have a variety of properties that…
Q: Draw the chemical structure of the 5' end of nascent RNA transcript in eukaryotes.
A:
Q: Flagellate protozoans live in the guts of termites. The flagellates break down the cellulose that…
A: Flagellate protozoans are free-living, non-photosynthetic protozoans. These lives inside the gut of…
Q: Marsupials
A: Mammals- an animal that breathes air, has a backbone, and grows hair at some point during its life…
Q: A student lists some characteristics of anaerobic respiration. 1. It produces 36 molecules of ATP.…
A: The process through which an organism receives energy is known as cellular respiration. Cellular…
Q: All the DNA extraction protocols suggest adding salts to the extraction buffer. What is the role of…
A: * Dna extraction can be done in following steps Breaking cells to release the DNA Separating DNA…
Q: Vida works in the haematology laboratory of a small hospital. The laboratory’s haematology procedure…
A: Introduction A blood smear, also known as a peripheral blood smear or blood film, is a thin coating…
Q: What is the role of the substrate? Is it really necessary to add substrates in ELISA? Why, or why
A: * ELISA is called as enzyme linked immunoassay which is used to detect antibodies in blood. *An…
Q: 1. The impact of diet on an individual may vary depending on the individual's genetic makeup. II.…
A: "Genes" are the fundamental unit of heredity. They store genetic information in the form of DNA,…
Q: during development, all cells have different genotypes and gene regulation allows different…
A: ANSWER;- true
Q: 1. 2. 3. 4. 5. Most Recent Varieties STRAWBERRY Its Characteristics How It Was Developed
A: Strawberries are available in different varieties the sweet aromatic flavour is widely considered…
Q: How does KU proteins promote DNA repair during mitosis? Explain.
A: DNA repair It involves different processes through which a cell determines and rectifies the damage…
Q: In Labrador retrievers, some puppies have pink noses and some have black. Labrador retrievers with…
A: *Given that In Labrador retrievers some puppies have pink noses and some have black noses * And…
Q: Uncontrolled diabetes mellitus, low-carb fad diets and starvation can lead to high levels of O…
A: Uncontrolled diabetes mellitus, low-carb fad diets and starvation can lead to high levels of ______…
Q: Which of the following statements BEST explains the relationship between the parts of genetic…
A: The hereditary substance in humans and almost all other animals is DNA, or deoxyribonucleic acid.…
Q: Write the word TRUE if the statement is correct; if not, write the WORD that makes it false.…
A: Under typical environmental conditions, biodegradation is the decomposition of materials into…
Q: In guine pigs, rough coat (R) is dominant to smooth coat (r). What is the expected percentage of…
A: ANSWER';- 50% Explain;- A heterozygous guinea pig (Rr) and homozygous passive guinea pig (RR) have a…
Q: If you have to choose the most obvious/important factor for a dominant transmission (between the…
A: The traits like dominant or recessive determine the inheritance patterns. These traits help in…
Q: 1.Statement 1: Antibodies are not specific for each type of antigen encountered by the body.…
A: Introduction Immune system:- It is a complex network of cells, tissues, organs, and the substances…
Q: Wild ungulates water depedency.
A: * wild ungulates respond to seasonal changes in temperature and precipitation by behavioural…
Q: the humoral response, some B cells differentiate into plasma cells. What do plasma cells produce in…
A: The humoral immune system interacts with antigens obtained from pathogens. These are freely…
Q: What factors would contribute to preservation of DNA?
A: Introduction DNA preservation (also known as DNA banking):- It allows you to store some of your…
Q: 1. Marsupials are unusual mammals because they carry their young in a oub. 2. Like most mammals,…
A: Marsupials are the members of mammalian infraclass Marsupialia.
Q: DNA replication is fast, virtually error-free, and coordinated with cell division. Discuss which of…
A: DNA replication is fast:- DNA replicates at a rate of 50 nucleotides per second. In both cases,…
Q: How does oxygen and carbon dioxide enter and leave the lung capilliaries respectively? (Multiple…
A: The billions of alveoli in the lungs, as well as the capillaries which surround them, interchange…
Q: 13.Why does carbon dioxide need to be transported in the form of bicarbonate ions? (This is multiple…
A: The transport of gases takes place via the blood from the lungs to tissues and vice versa. The O2 is…
Q: Which region will add the most people between 2013and 2050? Which will increase by the greatest…
A: Population growth can be defined as the number of individuals added in previous population in an…
Q: 15. differntial splicing allows a single gene to produce multiple proteins true or flasev
A: Alternative Splicing or Differential Splicing enables the inclusion or exclusion of particular exons…
Q: Evaluate whether the statements I and II are TRUE or FALSE.
A: Euchromatin is the light staining and less condensed portions of chromatin. This region is…
Q: Why are the testes located outside of the body of organisms?
A: Testes is located outside the abdominal cavity. Testes is present inside scrotum.
Q: in the human beta-globin, two introns are spliced out in order to produce the mature mRN
A: The gene regulation can be exercised at different levels where DNA can be packed tightly or loosely…
Q: Both cartilaginous and bony fishes have______ . a. jaws d. a swim bladder b. a bony skeleton e. a…
A: The term vertebrate is derived from the word vertebrae, which refers to the bones that make up the…
Q: It was discovered that COVID19 RNA is a sense (+) strand. If the RNA sequence that codes for the 5…
A: A sense strand, also known as a coding strand, is a stretch of double-stranded DNA that carries the…
Q: Did the five Big Extinction events in earth's history all occur due to the same environmental cause?
A: There have been five significant mass extinction events in Earth's 4.6 billion-year history, each…
Q: ASHRAE standard 55, Thermal Environmental Conditions for Human Occupancy, notes that for thermal…
A: A microbe is a living entity that is so tiny that it cannot be seen with the naked eye. Microbiology…
Q: A woman who is colorblind (XcXc) can expect 50% of her male offspring to be colorblind. 100% of her…
A: Introduction Color blindness is a condition in which you view colours differently than most people.…
Q: Describe the effects of streptococcal haemoysins giving an example of streptococci that can manifest…
A: A "microbe" is a living entity that is so tiny that it cannot be seen with the naked eye.…
Q: Which of the following describes passive immunity? Note: This is a multiple question, choose the…
A: When an individual receives antibodies to a disease instead of developing them by his or her own…
26
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Rectangular Snip Which of the following is the common ancestor of organisms E, F, G, H? В E IV II H. LILMolecular clock data place the evolution of diatoms around the time period following the Permian extinction. One hypothesis is that an adaptive radiation occurred as they colonized new marine niches. Based on what you know about the effects of ocean acidification on the formation of tests made from calcium carbonate and the composition of the tests (cell walls) of diatoms, what is a possible explanation for this diatom "explosion"? Edit View Insert Format Tools Table 12pt v Paragraph v A APR 18 étva. Phylogenetic relationships based on chloroplast genes Brown algae Diatoms Most photosynthetic dinoflagellates Cryptophyte algae Red algae Red algae Green algae Euglenids Green algae Chlorarachniophyte algae Green algae Green algae Green algae Green algae Land plants Glaucocystophytes Cyanobacteria b. Phylogenetic relationships based on nuclear genes Opisthokonts Amoebozoans Glaucocystophytes Red algae Green algae (including land plants) Cryptophyte algae 140000 Diatoms Brown algae Dinoflagellates Chlorarachniophyte algae Chloroplast genes relate brown algae, diatoms, most dinoflagellates, and cryptophyte algae to red algae, which is different from the relationships based on nuclear genes shown in part b. -Excavates Chloroplast genes relate euglenids and chlorarachniophyte algae to green algae, which is different from the relationships based on nuclear genes shown in part b. Chloroplasts form a monophyletic group nested within cyanobacteria, providing strong evidence for the…
- What difference would it make if the southern sea otter (Core Case Study) became extinct primarily because of human activities?From the DNA sequence data for the eight species (A through H) shown below, what is the genetic distance between Species A and Species C? O 4 5 6 1 O 7 2 3 4 Species A ACCAGCCTGTGCATCGATGACGACTAAGTGATACCATAAAG ACT Species B ACCAGCCTGTGCATCGATGACGACTAAGTGATACCATAAAGACT Species C ACGAGCATGTGCATCGATGCCGACTAAGTGATACCATAATGACT Species D ACGAGCATGTGCATCGATGCCGACTAAGTGATACCATAATGACT Species ACCAGCATGTGTATCGATGCCGACTAAGTGATACCAAAATGACT E Species Species F ACCAGCATGTGTATCGATGCCGACTAAGTGATACCAAAATGACT G ACCAGCATGTGTATCGATGCCGACTAAGTGCTACCATAATGACT Species H ACCAGCATGTGTATCGATGCCGACTAAGTGCTACCATAATGACT 5 6 7aterials Spirochaetes are free-living, anaerobic bacteria that contain spiral-shaped cells. Nematodes are roundworms that are incredibly diverse and, as a group, have adapted to survive in all environments. Which of the following statements accurately describes the DNA of both groups? * pdates ades embers nferences The spirochaete genome is smaller than the nematode genome. Q Online Nematode DNA is circular. sela Spirochaete chromosomes are composed of just DNA while nematode chromosomes also include specialized proteins. on Periods 1 and 2 eriods MP1, Highschool chool MP3, Spirochaete DNA is linear. MP4 Operons are clusters of genes that are regulated as a group. They can be characterized as either repressible or inducible. What is the main difference between the two? * d Thu Fri INTL 1
- The fossils in line 4 are blank the ones in line 1 of the diagram. A) much older B) much younger than C) slightly older than D) slightly younger thanIs it worth spending money to try to protectcoelacanths from being accidentally killed by fishermen, orshould scarce resources be instead devoted to preserving moreecologically important species and habitats?What assumption is made during the relative dating of fossils?