Q: What are your thoughts regarding the evolution of antibiotic resistant bacteria. Also find out where…
A: The emergence and proliferation of antibiotic-resistant bacteria present a significant challenge in…
Q: Explain the importance of the termination of cell signaling, and ways this can be accomplished
A: Cell signaling is a complex process by which cells communicate with each other to coordinate their…
Q: Question 10 What evidence led researchers to identify 18 codons in hemagglutinin gene as the…
A: This question addresses the evidence that led researchers to identify 18 specific codons in the…
Q: Match each figure to the correct descriptive term. Answer choices may be used only once. Not all…
A: Bacteria come in a variety of shapes and arrangements, which are important for identifying and…
Q: GR and PPAR are transcription factors that bind to GRE and PPARE sequences respectively and…
A: A reporter cell line is a stable cell line that has been labeled with a reporter gene, allowing the…
Q: After performing a plate and liquid lysate, it was found that the plate lysate achieved the common…
A: Viral titration is a laboratory method for figuring out how many infectious viral particles are…
Q: 2. Fill in the Blood Types table below. Antigens on RBCs Blood Type AB A B O Antibodies in blood Can…
A: The body's fluid connective tissue is called blood. Blood has a fluid component called plasma and a…
Q: Examples of taxes that are paid by businesses include which of the following? a) Sales Tax on sales…
A: Answer.) :-Taxes are a fundamental source of revenue for governments, supporting public services and…
Q: Select ONE toxicant and explain its sources and endocrine disruptor's characteristics. ( 10 )…
A: Introduction: The Intriguing Realm of Endocrine Disruptors:In the intricate tapestry of…
Q: Detail how your system works with this other system to maintain homeostasis (involve as many…
A: For this step, you will choose three regulated variables influenced by your assigned system and…
Q: Which of the following RNA Polymerases in Eukaryotes is responsible for producing pre-mRNA? a. RNA…
A: In eukaryotes, there are three different RNA polymerases that are responsible for transcribing…
Q: 6. A particular organism has 46 chromosomes in its karyotype. Which of the following statements is…
A: Specialized reproductive cells called gametes take part in sexual reproduction. Sex cells are…
Q: A woman has full ichthyosis - not patchy like the daughter described in Question 6, but all over her…
A: According to the guidelines of Bartleby,Since you have posted multiple questions, only the first…
Q: Chromatin Immunoprecipitation (ChIP) experiments enable researchers to measure the levels of…
A: LPS (lipopolysaccharide) treatment results in the recruitment of the transcription factor NfkB and…
Q: Describe the two classic patterns of propagation of infection in a population? How would you prevent…
A: Infection propagation in a group of people refers to the transmission of an infectious illness from…
Q: Hello! Discuss the oncosuppresive function of xenophagy. -is it oncosuppresive? How can it be…
A: The cellular process that involves the degradation and recycling of the cellular components, i.e.,…
Q: O B.2 O C.3 The figure below depicts the lac operon. OD. 4 Galac _ If all of the genes depicted are…
A: These are present within a specific region in the DNA(deoxyribonucleic acid) and are controlled by…
Q: Which pathway modifications does Cannabis makes to be able to make THCV. Answer should be in…
A: Cannabis is mostly used in the US as an illicit substance and in many countries. It is commonly…
Q: Pyruvate, formed from glycolysis, is generated in the: a. Cytosol b. Nucleus c. Mitochondrial…
A: All cells respire through a metabolic process known as cellular respiration,, in which free energy…
Q: The citric acid cycle occurs in the : a. Cytosol b. Mitochondrial matrix c. Inner membrane of…
A: Biochemical pathways are chemical reactions that occur in chains. Three major biochemical reactions…
Q: Human hair color ranges from black to many shades of brown to blonde. What can you correctly…
A: Dominant Allele: A dominant allele is an allele that, when present in a heterozygous genotype…
Q: 8. Which of the following changes does not occur during the fight or flight response - J Increased…
A: The "fight or flight" response occurs in response to a perceived threat or stress. It involves…
Q: 5. Which one of the following responses is most likely to occur when the body temperature of a…
A: Whenever the body's temperature falls below 95° F (35° C), hypothermia sets in. The average body…
Q: 8. Explain two different situations that would cause EPO release. 9. Explain why digestive enzymes…
A: "Since you have posted multiple questions, we will provide solution only to the first question as…
Q: A diploid cell undergoes meiosis to form the four gametes shown below. Part 1 H q H What is the…
A: Note: Since you have asked multiple questions, we will solve the first question for you. If you want…
Q: Which of the following is an advantage of sexual reproduction over asexual reproduction? has a lower…
A: A biological process called reproduction allows an organism to make children that are genetically…
Q: please help answer this question
A: The SARS-COV2 virus is the virus that causes pandemic disease name COVID-19. It gains entry into the…
Q: abnormalities in sex chromosomes during meiosis affects sexual development. Research other…
A: Meiosis is a type of cell division event that occurs during gamete formation. Sometimes non…
Q: create a Venn diagram of the following types of cell division processes: mitosis, meiosis, and…
A: A Venn diagram is a graphical representation used to visualize the relationships between different…
Q: The diagram below represents the process of: Question 14 options: mitosis binary fission…
A: The diagram represent the process of Conjugation.Below I am discussing details mechanism
Q: The process of oxidative phosphorylation occurs in the: a. Cytosol b. Mitochondrial matrix c.…
A: Respiration is of two types, aerobic and anaerobic. Aerobic respiration occurs in the presence of…
Q: Research for various evidences of a known and demic species in the Philippines that you are most…
A: In this task, we will research a specific endemic species in the Philippines and gather various…
Q: Question 7 Which of the following changes is most likely to occur as an immediate result of an…
A: Q 7.) :- ans.Luteinizing hormone (LH) is produced by the anterior pituitary gland in response to the…
Q: 1 at birth 1 2 This pedigree illustrates the occurrence of neurofibromatosis in a small human family…
A: A pedigree is a chart that delineates the hereditary ties and patterns of inheritance between…
Q: What is the difference between: CYP3A4*1 and CYP3A4*2 CYP1A1*2B and CYP1A1*2C i. ii. i. ii. Briefly…
A: The provided questions address the differences between specific allelic variants of genes associated…
Q: Which of the following statements is not true? Carbohydrates are the building blocks of proteins…
A: Carbon, hydrogen, and oxygen atoms make up the chemical molecules known as carbohydrates. They act…
Q: What is this? What special ability does it have? Does it have organelles to perform this activity?
A: The phylum of gram-negative bacteria known as cyanobacteria, sometimes known as Cyanobacteriota or…
Q: In the article "Sherlock: nucleic acid detection with CRISPR nucleases" by Max Kellner et al.…
A: The provided statements relate to the utilization of CRISPR technology in disease detection,…
Q: Outline the structure of muscle fibres and their requirement for energy and explain the difference…
A: There are three types of muscles present in our body, skeletal muscle, smooth muscle and cardiac…
Q: Let's say that you're a scientist trying to analyze newly sequenced bacterial DNA genomes from an…
A: Creating a phylogenetic tree is about identifying the genetic sequences that have variation across…
Q: Which of the following correctly pairs the structure with its product? O corpus luteum-inhibin O…
A: The body's network of glands that produce and discharge hormones is known as the endocrine system.…
Q: Which statement is NOT true of membrane transport • proteins? A. Their specificity depends on their…
A: They are integral membrane proteins that facilitates the movement of various substances across the…
Q: Below is a primary spermatocyte in metaphase I of meiosis. The chromosomes have already replicated…
A: Meiosis is a type of cell division that occurs in the reproductive cells and leads to the formation…
Q: What is happening at each indicated time on this graph? Log₁ number viable cells A B C D E A B C…
A: Growth is the characteristic of living organisms that increases the number of cells in multicellular…
Q: When food reaches the back of the throat the swallowing reflex occurs. Which of the following…
A: Reflex action denotes an immediate and automatic reaction to certain stimuli. This process aids…
Q: b.
A: The labelling of the diagram is provided below.
Q: Was either allele completely eliminated by the 10th generation? Why or why not?
A: Answer.) :- In a study spanning ten generations, the gene pool's allele frequencies were tracked for…
Q: 10. Which one of the following statements is true of the regulation of activities in the human body?…
A: According to the guidelines of Bartleby,Since multiple questions are posted the expert can only…
Q: https://www.researchgate.net/publication/235324145_Quantitative_Genetic_Application_in_the_Selection…
A: The study "Quantitative Genetic Application in the Selection Process for Livestock Production"…
Q: Although SINES are nonautonomous, they do occasionally move from one genomic site to another. How is…
A: SINEs are non-autonomous transposable elements, meaning they rely on other transposable elements for…
Can you further explain the second primer how we get that and possibly draw it out?
GTCAAATTACATTACACATAA
Step by step
Solved in 3 steps
- Hi, I would like to know which program is used for the graphical presentation of the results of a meta-analysis of genome-wide linkage scans?As a technique for detecting genetic variations, RFLP has substantial drawbacks. Name one such drawback, explain why it is unique to RFLP analysis with specific reference to the technique, and discuss why DNA sequencing overcomes this drawback. Please leave the link for any sources used. Thanks!Is this a sequencing by synthesis method? Explain.
- Below are 9 possible primer pairs.● Determine which primer pair is the best choice.● Explain why the other primers are not good choices.● Calculate the Tm for each primer. Underline or highlight the region of DNA for the primer pair you chose as the best.Forward 1: 5’ gaaataattttgtttaactttaag 3’ Tm =Reverse 1: 5’ gtttaagacaaaatagtctgg 3’ Tm =Forward 2: 5’ gtaactcagctttcaggtcg 3’ Tm =Reverse 2: 5’ tctcggaatgttgcaacagc 3’ Tm =Forward 3: 5’ agattagcggatcctacctg 3’ Tm =Reverse 3: 5’ atgtgtaatcccagcagcag 3’ Tm =Forward 4: 5’ cattgattatttgcacggcg 3’ Tm =Reverse 4: 5’ aaaatcttctctcatccgcc 3’ Tm =Forward 5: 5’ tccataagattagcggatcc 3’ Tm =Reverse 5: 5’ tgcaagcttggctgttttgg 3’ Tm =Forward 6: 5’ gatcctacctgacgcttttta 3’ Tm=Reverse 6: 5’ aaataatgaattcgagctcggt 3’ Tm =Forward 7: 5’ataaaaaaatcgagataaccgtt 3’ Tm =Reverse 7: 5’aggtcgactctagaggatc 3’ Tm =Forward 8: 5’ctacctgttccatggccaac 3’ Tm=Reverse 8: 5’ ttcgggcatggcactcttg 3’ Tm=Forward 9: 5’ tccataagattagcggatcc 3’ Tm =Reverse 9: 5’…Why a multiple sequence alignment is needed for researchers? What inferences can be derived from this kind of sequence alignments? Explain two extreme cases that are non-informative for the multiple sequence alignment.Generate a primer pair that is 6 base-pairs long to amplify the inversion, that will notamplify wildtype mini gene 5' ATGGTGCAAGATTAA 3' 3' TACCACGTTCTAATT 5'
- Can you help with 1a please HELPFUL INFORMATION: When performing classical Sanger or "dideoxy" sequencing, you set up 4 parallel reactions per template to be sequenced from a specific primer, with each of the four reactions containing a different dideoxynucleotide, and then the four reactions were run in a separate, adjacent lanes on a gel. 1a. Why couldn't you combine all 4 dideoxynucleotides with the primer and the template and do the whole reaction in one tube, and then run the set of fragments produced by the reaction mixture on a single lane in an acrylamide gel?a - What is Position-Specific Scoring Matrices (PSSM) and how do we obtain it? b - Construct the HMM for the following sequences where the matches are considered for the columns that don't have any gap T G A A G T T G A I A G G C A G T G G C T A GSecond Base Analyze the following DNA sequences: A UUU UCU UAU UGU Phe Tyr UUC UCC UAC UGC Original: AGAGAGAGAGAGAGAGAG Ser UUA UCA UAA Stop UGA Stop Leu UUG UCG UAG Stop UGG Trp CUU CCU CAU CGU His Mutated: AGAAGAGAGATCGAGAGA CUC CC CAC CGC Leu Pro Arg CỦA CCA CAA CGA Gin CUG CCG CAG CGG AUU ACU AAU AGU Ser Asn What amino acid sequence will be translated based on the AUC Ile ACC AAC AGC The mutated DNA? Hint* must transcribe and translate the AUA ACA AGA AAA arg Lys Met or Start AUG ACG AAG AGG mutated strand to find the answer. GUU GCU GAU GGU Asp GUC GCC GAC GGC Val Ala Gly G GUA GCA GAA GGA Glu GUG GCG GAG GG First Base Third Base
- In a genome project, the following genomic DNA sequences were obtained. Assemble the sequences into a contig. Using the assembled sequence, perform a BLASTn search. Does the search produce sequences similar to your assembled sequence? 5’ TCGGGGTCCTGGGATCTCATCACTGCAGCGC 3’ 5’ACTGCAGCGCTTTCCCAGCGGGCGGTGGTAC 3’ 5’GGGCGGTGGTACTCGGGAAGTCAGGAGTGTT 3’ 5’AGGAGTGTTTAAAACCTGGGGACTGGTTTTG 3’ 5’TGGTTTTGGGGGCGCTGAAGGCAGCGCAGGA 3’For the following sequence please design an 18 base pair forward primer. ATG TCA AAA GCT GTC GGT ATT GAT TTA GGT ACA ACA TAC TCG TGT GTT GCT CAC TTT GCT TAAEhat primer sets could be amplify the following DNA sequence? AATACGTCGCATGGggatccttttttatgcatg
