Derive the amino acid sequence that is coded for by each of the following mRNA sequence. 5' CAA GAG GUA UCC UAC AGA 3' 5' GUC AUC UGG AGG GGC AUU 3' 5' CUA UGC AGU AGG ACA CCC
Q: 1.Classify each protein as fibrous or globular. A. hemoglobin B. keratin C. myoglobin
A: Proteins are classified into two categories, on basis of shape and solubility. 1. FIBROUS PROTEINS...
Q: What is the general definition of an uncoupler protein? In the context of oxidative phosphorylation,...
A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids conta...
Q: A peptide has the following amino acid composition: 2 Met, 2 Phe, 2 Glu, 1 Arg, 1 Lys, 1 Val, 1 Leu,...
A: The amino acid sequence of a peptide is called the primary structure of a protein and determines the...
Q: Which of the following statements regarding size exclusion chromatography is false? During siz...
A: Hi! Thank you for the question, as per the honor code, we are allowed to answer the first...
Q: Enumerate the similarities and the differences of Chlorophyll A and B. Similarities Differences
A: Introduction: Chlorophyll is a natural fat-soluble molecule found in plants that allow plants to con...
Q: GIVEN: Centrifuge A: rotor radius - 5 cm; max. speed - 4,000 xg Centrifuge B: rotor radius - 7 cm; m...
A: Centrifuge is a device used for separating molecules having different densities. The process is call...
Q: Propose a reasonable pathway to degrade the following amino acid to core metabolic intermediates. Me...
A: In the given amino acid structure, there is additional amino group in sidechain and structure is sim...
Q: Given the following reaction, identify the class and subclass of the enzyme involved. CH,OPO,2- CH,O...
A: Enzymes are biocatalysts that speed up biochemical reactions. These are mainly three dimensional glo...
Q: 12. RNase A is a ribonuclease enzyme that degrades single stranded RNA. There are three key amino ac...
A: RNaseA catalysis is a typical example of acid base catalysis. Histidine is a common amino acid in th...
Q: Which of the following statements are TRUE about eukaryotes? (i) They are cells with a nucleus. (ii)...
A: Cell is the structural and functional unit of life. It can be classified into prokaryotic and eukary...
Q: Given the active site and reaction mechanism below, what is the mechanism of rreversible inhibition ...
A: The mechanism followed by the given example is of Transition state analog Chemical compounds with a ...
Q: 4. A polypeptide comprised of 17 amino acid res- idues with the sequence on the right is ob-served b...
A: The peptide sequence using 3 letter amino acid code is given below. N-Glu-Thr-Ala-Thr-Lys-Ala-Glu-Le...
Q: ummarize what happens during protein processing
A: To be functional, all freshly produced polypeptides must be folded into their three-dimensional stru...
Q: During the formation of the peptide bond which of the following takes place? a. Hydrogen atom is lo...
A: Between the α-nitrogen atom of one amino acid and the carbonyl carbon of another, a peptide bond, al...
Q: 2 Two version of the same enzyme were isolated, a wild type and a mutant differing at a single amino...
A: Enzymes are protein molecules that increase the rate of reaction by decreasing the activation energy...
Q: king of acid
A: Acid is the substance which turns blue litmus to red. Acid contains more H+ ions. Acids acts as prot...
Q: Given the active site diagram below, identify the numbered region corresponding to an acidic catalyt...
A: An acid is a molecule that can accept a proton from the solution and a base is a molecule that can d...
Q: Given the active site and reaction mechanism below, what is the mechanism of irreversible inhibition...
A: The given example is uncompetitive inhibition. Uncompetitive inhibition, also known as anti-competit...
Q: Choose among proteins A, B, C, and D. 1. Protein that will most strongly bind to an anion exchange ...
A: Chromatographic techniques are used to separate specific molecules from a mixture of different molec...
Q: Ethidium Bromide is a chemical reagent that has been used to detect the presence of nucleic acids. I...
A: Nucleic acids are of two types : DNA and RNA. DNA refers to Deoxyribonucleic acid. It is genetic mat...
Q: Test Done and Result Carbohydrate Identity Molisch test Seliwanoff's test Benedict's test Barfoed's ...
A: Carbohydrates or carbs are maconutrient consisting of Carbon, hydrogen and oxygen atoms. In nature t...
Q: Write the structure formula, three-letter and one-letter abbreviation for each essential amino acid ...
A: There are twenty naturally occurring amino acids that form proteins in biological systems.
Q: A. Heteroglycans are polysaccharides with only one type of monosaccharide unit. Heparin is a heterog...
A: Polysaccharides that are comprised of same type of monosacharide units, then it is termed as homopol...
Q: or each solution, calculate the rate of weight change over this 30-minute period. *****Please Show...
A: Given the weight of potatato slices immersed in 0M, 0.4M 0.6M, 0.8M and 1 M sucrose solution over 30...
Q: I. True or False a. The beta-pleated sheets are formed by H-bonds among adjacent regions of the pe...
A: A. FALSE - The beta-pleated sheets are formed by H-bonds between neighbouring strands.
Q: What is experiment of Thermodynamics of Small Oligomeric Duplex DNA Denaturation.
A: Double-stranded DNA is the most common kind of DNA molecule found in nature. The strands can be unwo...
Q: 2. You have made a mutation in myoglobin that increased the Pso for O2 by a factor of 2. Sketch out ...
A: Myoglobin is a non-allosteric enzyme found in muscle cells. The main function of myoglobin is to sto...
Q: 3. When you think about the primary structure of the mannose-6-P receptor, assuming that it is an in...
A: The internal amino acid sequences in the membrane protein carries the information that determines th...
Q: For the ion concentrations in Table 12.1, calculate the equilibriumpotentials for each ion species i...
A: ions can move in either direction through a channel (i.e., either into or out of the cell) the d...
Q: Identifies the roles of ventilation and PCO₂ in acid/base balance . Answer ASAP .
A: Acid is present in body in stomach.Acid and base balence in body is important for human health.Acid ...
Q: Which of the following contain a correct first statement and an incorrect second statement? Be...
A: G proteins consist of the alpha, beta and gamma receptors for activating the cell signaling mechanis...
Q: How does a protein form?
A: Proteins are the heteropolymers of twenty standard amino acids attached together via peptide bonds. ...
Q: Uncatalyzed -Enzyme A - Enzyme B C12H22011 + H,0 2C,H,,0. For the reaction shown, it can reasonably ...
A: Enzymes are biocatalysts which increase the rate of biochemical reactions by decreasing the activati...
Q: Biochemistry Question: Nonenzymatic glycosylation or glycation creates glycoproteins by
A: What is glycoproteins: Glycoproteins are molecules that comprise protein and carbohydrate chains tha...
Q: 2. Calculate the overall charge (pH 7) on the following three polypeptides and answer the questions ...
A: Hi! Thank you for the question. We are authorized to answer three subparts at a time, since you have...
Q: 32. Which one of the following is NOT a typical characteristic of the active site of an enzyme? A) T...
A: Substrate molecules bind to the enzyme, which then undergoes a chemical reaction. The active site is...
Q: Please provide a chromatography technique to isolate the protein A from the mixture containing prote...
A: Protein A :- positively charged Protein B :- negatively charged For separation of charged molecules ...
Q: 29. Here is a strand of DNA: TACCCGGTATAACGCTGGAAAGCTTAAGCAACATCGCCCGACCCC AAATCT ATGGGCCATATTGCGACC...
A: DNA strand given here with directionality is as: 5’ TACCCGGTATAACGCTGGAAAGCTTAAGCAACATCGCCCGACCCCAAA...
Q: The restriction digests of the cloned Drosophila gene can provide direct visible evidence of a mutat...
A: We can use the technique of Southern blotting to detect and isolate the DNA fragment with the Gene O...
Q: At eukaryotic origins of replication, helicase cannot be activated until the polymerase is also posi...
A: Deoxyribonucleic acid, or DNA, is a type of biomolecule known as nucleic acid. The important compone...
Q: Explanations are not needed. Direct answers are enough. II. True or False a. An effort is usuall...
A: The protein molecules after their folding have exposed patches of charged amino acids on their surfa...
Q: What are the biomolecules that are used to biosynthesize a purine ring in the de novo pathway – prov...
A: Purine de novo synthesis is a time-consuming process. It happens actively in the liver cytosol, wher...
Q: 2. The kinetic effect of purely competitive inhibitor of an enzyme: (A) Increases K without affectin...
A: Hi. Thank you for the question. As per the honor code, we are allowed to answer three sub-parts at a...
Q: Typically, opiates have the ability to a. cause intense hallucinations. b. suppress the sensation of...
A: The correct answer is b. suppress the sensation of pain A drug that is used to relieve pain or induc...
Q: unfold the protein
A: here they are talking about protein unfolding. The tension applied by the cantilever during protein ...
Q: Name the following nucleotide: HN P-0-P-0-CH2 OH
A: Nucleic acids are macromolecules. These are of two types - Deoxyribonucleic acid (DNA) and Ribonucle...
Q: Answer choices are provided below for drop-down questions. 1. The overall charge of this protein at...
A: Since you have asked multiple questions and haven't specified which has to be answered. Therefore, a...
Q: Some mice have a mutation in the liver isozyme of pyruvate kinase leading to an inability to be phos...
A: Pyruvatw kinase in an enzyme which is involved in the glycolysis process. In Glycolysis, the cycle A...
Q: 2. Draw the structure of the tripeptide Gly-Ala-Tyr H H. N-C-C H N-C-C + N-C-C + H он он CH3 H. 0-H ...
A: Proteins have four levels of structural organization including Primary, secondary, terti...
Q: Why is stereochemistry of biomolecules important in biological processes?
A: Stereochemistry is the Study of three dimensional structure of molecules and their effect on the fun...
Derive the amino acid sequence that is coded for by each of the following mRNA sequence.
- 5' CAA GAG GUA UCC UAC AGA 3'
- 5' GUC AUC UGG AGG GGC AUU 3'
- 5' CUA UGC AGU AGG ACA CCC
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- The following is a portion of a protein: met-trp-tyr-arg-gly-pro-thr-Various mutant forms of this protein have been recovered. Using the normal and mutant sequences, determine the DNA and mRNA sequences that code for this portion of the protein, and explain each of the mutations. a. met-trp- b. met-cys-ile-val-val-leu-gln- c. met-trp-tyr-arg-ser-pro-thr- d. met-trp-tyr-arg-gly-ala-val-ile-ser-pro-thr-Given the following mRNA, write the double-stranded DNA segment that served as the template. Indicate both the 5 and the 3 ends of both DNA strands. Also write out the tRNA anticodons and the amino acid sequence of the protein encoded by the mRNA message. DNA: mRNA: 5-CCGCAUGUUCAGUGGGCGUAAACACUGA-3 protein: tRNA:Consider the following mature mRNA from a human cell: 5' UAAUGUCGCAAUAACC 3¹ What is the sequence of amino acids in the translated protein? Second letter A First letter С U d A G บบบ UUC P U UUA UUG Leu CUU CUC CUA CUG GUU GUC GUA GUG -Phe Met-Ser-Gln Met-Arg-Lys-Ser Leu Stop-Cys-Arg-Asn-Asn C AUU AUC lle AUA ACA AUG Met ACG Val UCU UCC UCA UCG CCU CCC CCA CCG ACU ACC GCU GCC GCA GCGJ Ser Pro Thr Ala UAU UAC Tyr UGU UGC. UAA Stop UGA Stop UAG Stop UGG Trp CAC CAGGin CAU His Select an answer and submit. For keyboard navigation, use the up/down arrow keys to select an answer. AAU Asn AAA Lys AAG. There is no start codon, resulting in no translated protein. GAU ASP GAC Glu GAA GAG G CGU CGC CGA CGG Cys AGU AGC AGA AGG Arg GGU GGC GGA GGGJ Arg ser Gly MCAG U UCAG с А SCAG U SCAG U Third letter
- Using the genetic code table provided below, identify the open reading frame in this mRNA sequence, and write out the encoded 9 amino acid long peptide sequence: 5'- CGACAUGCCUAAAAUCAUGCCAUGGAGGGGGUAACCUUUU C A G U UUU Phe UCU Ser UUC Phe UCC Ser UAC UCA Ser UAA UCG Ser UAG UUA Leu Leu G C CUU Leu CUC Leu CCC CUA Leu CUG Leu AUU lle AUC lle AUA lle AUG Met ACG ACU Thr ACC Thr ACA Thr Thr A UAU Tyr UGU Cys Tyr UGC Cys CCU Pro CAU His CGU Arg Pro CAC His Pro CAA Gln CGC Arg CGA Arg CCA CCG Pro CAG Gln CGG Arg GUU Val GCU Ala GAU GUC Val GCC Ala GAC GUA Val GCA Ala GAA GUG Val GCG Ala GAG Stop UGA Stop UGG AAU Asn AAC AAA AAG AGU Asn AGC G Lys Lys Asp Asp Glu Glu Stop A Trp Ser Ser AGA Arg AGG Arg GGU Gly GGC Gly UCAG GGA Gly GGG Gly с U C A G U C A G U C A GFor the messenger RNA sequence below, find the beginning of the amino acid coding sequence and translate the sequence using the genetic code provided below. 5' - AAUUAUGGGCAAUAUGCCGGGCcGGUUAAGCG - 3' Second Letter A UGU cys u UGC Phe UCU UU U UUC UUA UAU Tyr Ser UAC UAA UAG Leu UCA Stop UGA Stop UUG UCG Stop UGG Trp CUU CU CAU His CGU c cuc Leu ccc ССА CCG Pro CÁC CAA CAG CGC CGA CGG Arg CUA CUG Gin 1st 3rd letter Ser u letter AUU ACU AAU AAC AAA AAG Asn A AUC AUA AUG lle ACC ACA AGU AGC AGA AGG Thr Lys Arg Met ACG GUU G GUC GUA GUG GCU GAU GAC GAA Asp GGU Val GCC Ala GGC Gly GCA GGA Glu GCG GAG GGG GThe amino acids, in one-letter symbols and no spaces, coded by the following mRNA sequence is 5’ AAUGGAACGUCGGUACUGCCAUCGCAUUAGUACCAUGGCAAGCUGAAGC 3’
- Which of the following polypeptides (written from their N terminal ends) is encoded by the following mRNA? (hint: there is no left or write in a cell!) 3' GG AUG AGU AUA CUU ACG GGU GAA GUA CAU UAA CCC C5' O O O Met Lys Trp Ala Phe lle Met Ser lle Leu Thr Gly Glu Val His Tyr Lys Arg Thr Phe Tyr Met none of the above His Val Glu Gly Thr Leu lle Ser MetProvide the abbreviation for the amino acid sequence expected from the following mRNA segment using the three-letter amino acid codes: 5' UUUICCCIAAUIAUUIACG 3'Using the genetic code table provided below, write out the sequence of three different possible mRNA sequences that could encode the following sequence of amino acids: Met-Phe-Cys-Trp-Glu C A G U C UUU Phe UCU Ser UUC Phe UCC Ser UCA Ser UUA Leu UUG Leu UCG Ser CUU Leu CCU Pro CUC Leu CUA Leu CUG Leu CCG A CAU His CGU Arg CCC Pro CAC His CGC Arg UAU Tyr UGU Cys U UAC Tyr UGC Cys C Stop UGA Stop Stop UGG Trp UAA A UAG G CCA Pro CAA Gln Pro CAG AUU lle AUC lle AUA lle AUG Met ACG G 등등 Gln CGA Arg CGG Arg ACU Thr AAU Asn AGU Ser ACC AAC Asn AGC Ser Thr ACA Thr Thr AAA Lys AGA Arg AAG Lys AGG Arg GUU Val GCU Ala GAU Asp GGU Gly GGC Gly GUC Val GCC Ala GAC Asp GUA Val GCA Ala GAA Glu GGA Gly GUG Val GCG Ala GAG Glu GGG Gly U C A G U C A G SUAU
- Derive the amino acid sequence that is coded for by the following mRNA sequence. 5' CAU AAA ACG GUG UUA AUA 3'For the following mRNA sequences, what is the amino acid sequence formed? Consult genetic code table for reference. 5' AGUCCGUAC 3' 5' AAUUGCUUC 3'For the following mRNA sequence (reading from left to right) what will be the amino acid sequence following translation? (Use chart provided) AUGCCAGUUGAAUAA First position U C A UUU UUC UUA UUG CUU CUC CUA CUG U >Phe GUU GUC GUA GUG >Leu >Leu AUU ACU AUC lle ACC AUA ACA AUG Met/start ACG >Val UCU UCC UCA UCG ©2019 Pearson Education, Inc. CCU CCC CCA CCG GCU GCC GCA GCG Second position A >Ser >Pro Thr >Ala UAU UGU U UAC UGC C UAA Stop UGA Stop A UAG Stop UGG Trp G CAU CAC CAA CAG AAU AAC AAA AAG GAU GAC GAA GAG Tyr >His >Gin >Asn >Lys >Asp >Glu CGU CGC CGA CGG AGU AGC AGA AGG G GGU GGC GGA GGG >Cys Arg >Ser >Arg >Gly DOAG SCAG U с А UCA с А G Third position Correct answer not given Met-Val-Tyr-Pro Met-His-Phe-Ala-Arg Pro-Val-Met-Leu-His Met-Pro-Val-Glu