Q: Create a 75-nitrogenous base long DNA and replicate it completely. Make sure initiation, elongation…
A: DNA replication is the process of reproducing a double-stranded DNA molecule into two identical DNA…
Q: Explain the evolutionary relationship between the fin of a fish and the flipper of a whale.
A:
Q: Mutating the gene Transformer (tra) in Drosophila that is chromosomally XX leads to the development…
A: A mutation is a change in an organism's DNA sequence. Mutations can occur as a result of mistakes in…
Q: comparison of the worms' body structures:
A: Platyhelminthes also called flatworm. They are the group of soft-bodied, usually much flattened…
Q: Order the events leading to muscle contraction. Ca ions bind to troponin myosin binds to actin…
A: Muscle contraction It is defined as the muscles tightening or lengthening during performing an…
Q: Select two of the following major meridians that are paired and answer the Five associated…
A: Disclaimer: “Since you have posted a question with multiple sub-parts, we will solve the first three…
Q: Describe in detail the type of immune reaction someone would have on their first and second…
A: Introduction - Toxicodendron radicans is the poison ivy plant in the eastern United States, and…
Q: What causes allele frequencies to differ between biological populations?
A: Allele frequency Allelic frequency can be defined as relative frequency of an allele at a…
Q: True or False: 1. Lytic viruses utilize the host’s machines to construct their viral components…
A: The term 'virus' is derived from the same word in Latin, meaning venom or poisonous fluid. It was…
Q: Complex III delivers 4 protons. Where do these 4 come from UQH2 mitochondrial intermembrane space…
A: Introduction :- The electron transport chain's Complex III, also known as Q-cytochrome c…
Q: The standard clotting/coagulation screen (PT, APTT, fibrinogen) and platelet count is the most used…
A: The prothrombin time (PT) test measures how well and how long it takes your blood to clot. It…
Q: a gene insert itself into a bacterium’s Genome often distracting part of the genome. This is an…
A: Several types of techniques are incorporated in the molecular biology to get more desirable results…
Q: Describe the process of DNA replication of the leading strand?
A: DNA replication It is the process by which DNA make exact copy of itself. The replication of DNA is…
Q: 40 words or fewer. Explain why we would not survive without primary producers, in particular…
A: Introduction :- Primary producers, also known as autotrophs, are organisms that get their energy and…
Q: how is genetic information organized in a cell
A: Heritable biological information is encoded in DNA or RNA nucleotide sequences (some viruses), such…
Q: mechanisms of resistance to different xenobiotics (general groups of protection, efflux pumps,…
A: Xenobiotics are chemical substances in animal body which are not natural to be found in animal or…
Q: True or False: 1. All functional transcripts have been initiated, elongated and terminated with…
A: False : post transcription events include splicing, capping, tailing. Initiation is the beginning of…
Q: Explain in detail how phosphorylation of retinoblastoma (rb) protein leads to transition of the cell…
A: The RB1 (retinoblastoma 1) gene codes protein called pRb. It is a tumor suppressor gene (genes whose…
Q: Solve indigital format Cyanide is known to be an inhibitor of the electron transport chain in…
A: After Cyanine poisoning, electron transport chain cannot pupm electron into intermembrane space.…
Q: Assignment in Modules 4-6 Matching Type: Match Column A with Column B. Type the answer before the…
A: 1) phenylketonuria is the genetic defect in which the child is unble to breakdown the protein called…
Q: Match the artificial conception methods with their descriptions. Question 23 options: donor…
A: Fertilization: Fertilization, also known as syngamy and impregnation (note spelling changes), is the…
Q: Describe the process of DNA replication of the leading strand?
A: ANSWER;-
Q: The form of oxygen found toxic to microorganisms is rendered non-toxic by a. Superoxidase which…
A: Superoxide is composed of highly reactive oxygen atoms. It has the ability to reduce metal ions and…
Q: Describe the process of Translation of MRNA to DNA.
A: Translation is the second phase of protein synthesis. It follows transcription, in which the…
Q: Order the events leading to the sperm's nucleus fusing with the egg's nucleus. Question 1…
A: Fertilization is defined as the union of sperm and ova. Fertilization leads to formation of zygote.
Q: Covid 19 and plague differences
A: Pathogens are the organisms that cause diseases.
Q: List down the protected areas in REGION 12 (Soccsksargen), PHILIPPINES and the endemic species…
A:
Q: Trypsin digestion of the peptide sequence M3-E4-R5-P6-F7-Hg-Ag-10-A11-R12-T13-Y14- G15-P16 results…
A:
Q: All the body systems work together to maintain homeostasis in the organism. No organ system operates…
A: Introduction :- Large insoluble food molecules are broken down into small water-soluble food…
Q: how does hamilton's rule predict what's going on? 2. can kin selection explain eusociality?
A:
Q: Where would you expect a polypeptide region Ridge and the amino acid valine, leucine, and isoleucine…
A: Amino acids are the building blocks of life. Proteins are long chains of amino acids that make up…
Q: Given the scenario, compute for the total volume of the culture media solution (milliliter or liter)…
A: We have been given the concentration of the nutrient broth and Agar and we have also been given the…
Q: Explain how Hepatitis B, C, D and G occurs and what is the etiology of each one. Explain how AIDS…
A: In patients with weaker immune systems, such as people living with HIV, opportunistic infections…
Q: Explain the evidence that our species originated in Africa.
A: Introduction :- A species is commonly defined as a collection of organisms that can reproduce…
Q: A microorganism that uses just nitrogen to generate energy would be classified as
A: Nitrogen is required by all living organisms for the synthesis of organic molecules such as amino…
Q: A researcher wants to cut this piece of linear DNA. 5 AGCTAGTCCGGATCCGAGGGCCCTTCTCATGAGATCCGGATGACC…
A: The discovery of restriction enzymes in 1968 by Swiss scientist "Werner Arber" ushered in the era of…
Q: A B, and Cgenes are linked with Bin the middle. AB are 12 cM and BC are 20 cM apart. If ABdabC is…
A: If the geans are located on the same chromosome then they are called as linked genes. In this…
Q: Give a brief summary of the two-step procedure for identifying the tunicate embryo's marginal cells.
A: Tunicates are marine invertebrate chordates that are vertebrates' closest relatives. Ascidians are…
Q: CASE 1: A dying patient is experiencing agony and there is no medical relief available. Her life can…
A: Euthanasia: Euthanasia is the deliberate ending of a person's life in order to relieve pain and…
Q: How can the hypothesis that asserts that chloroplasts as well as mitochondria were primitive…
A: INTRODUCTION Mitochondria are called the powerhouse of the cells converting fuel molecules into…
Q: Differentiate Protostomes from Deuterostomes in terms of the formation of cleavage
A:
Q: Compare and contrast the immune system/immune response between plants and animals using a Venn…
A:
Q: Compare the bodies of an Old World monkey, a New Worldmonkey, and an ape, giving examples of each.
A: Callitrichidae, Cebidae, Aotidae, Pitheciidae, and Atelidae are the five primate families that make…
Q: Coelochaetes (green algae) Charophytes (green algae) Ancestral green algae Bryophytes…
A: Phylogenetic tree Phylogeny is the study of the history of the evolutionary relationship between…
Q: Cell membranes can maintain a difference in electrical charge between the inte- rior of the cell and…
A: Introduction The plasma membrane or cell membrane is the outer layer of all cells, however it is…
Q: A farmer wants to breed a variety of taller corn. a) How can the farmer use variation in the height…
A: Introduction Selective breeding involves pairing up parents with similar characteristics in order to…
Q: ANSWER THE SAME ANSWER ANYMORE. PLEASE INCLUDE REFERENCES I NEED IT. MAKE IT DETAILED IN ONE…
A: Endometrial polyp is abnormal growth after menopause in uterus. But also present unusually in young…
Q: SARS-CoV-2 was shown to be transmissible even when the carrier has no symptoms. How did this…
A: SARS virus is a positive strand RNA virus and belongs to coronavirus family.
Q: (Select one answer from each dropdown menu:) DNA replication uses as templates to make an Choose…
A: Replication is a process by which two identical copies of DNA are produced. The two new daughter…
Q: Differentiate flexion from torsion. Why do these events occur in the developing embryo?
A: Answer--
Step by step
Solved in 2 steps
- Skin cancer carries a lifetime risk nearly equal to that of allother cancers combined. Following is a graph [modified fromK. H. Kraemer (1997). Proc. Natl. Acad. Sci. (USA) 94:11–14]depicting the age of onset of skin cancers in patients with orwithout XP, where the cumulative percentage of skin cancer is plotted against age. The non-XP curve is based on 29,757 cancerssurveyed by the National Cancer Institute, and the curverepresenting those with XP is based on 63 skin cancers from theXeroderma Pigmentosum Registry.For many years, targeted therapies for cancer treatment continue to be developed, however more and more patients are developing resistance to targeted therapies. Discuss one mechanism of resistance to targeted therapies for cancer and provide an example of how might creatively combat it using clinical concepts.1) A) List 15 drugs (monoclonal antibodies can be used) used clinically to treat cancer in humans. These targets must be signal transduction pathway components. B) For each drug, list the specific protein targeted. C) For each drug, describe the efficacy of treatment (i.e. what is the success rate in life extension) as well as appropriate cost of treatment whether it be per round or an average annual cost.
- 1. Describe & explain the pathophysiology of cancer based on the diagram. Reference: https://www.onlinebiologynotes.com/cancer-etiology-pathophysiology-types-diagnosis-and- treatment/ Acquired (environmental) DNA damaging agents: • chemical • radiation viruses Activation of growth- promoting oncogenes NORMAL CELL DNA Damage Failure of DNA repair Mutations in the genome of somatic cells Alteration of genes that regulate apoptosis Malignant neoplasm / Successful DNA repair CANCER Inherited mutations: • Genes affecting DNA repair • Genes affecting cell growth Expression of altered gene products and loss of regulatory gene products Inactivation of cancer suppresor genes Clonal expansion Additional mutations (progression) T HeterogeneityExplain Three mechanisms for viral induction of cancer.Heterotypic interactions of tumor cells have been a fertile area for potential therapeutic interventions. Find a specific example of a drug/therapy that targets these interactions and explain the mechanism by which it treats cancer.
- Explain the mechanism of warburg effect and how it benefits cancer cells. Include citations and referencesTissues and differentiation a)Explain what is meant by termination and differentiation ).b) Explain the difference between an oncogenic and a tumour suppressor gene and describe how they are involved in the onset of cancerDiscuss the purpose and role of the various treatment modalities in the management of cancer
- Our government has finite funds to devote to cancer research.Discuss which of the following areas of research you think shouldreceive the most funding.A. Identifying and characterizing oncogenes and tumorsuppressorgenesB. Identifying agents in our environment that cause cancerC. Identifying viruses that cause cancer D. Devising methods aimed at killing cancer cells in the bodyE. Informing the public of the risks involved in exposure tocarcinogensIn the long run, in which of these areas would you expect successfulresearch to be the most effective in decreasing human mortalitydue to cancer?What percentage of cells in an organ or a tissue need toexpress a therapeutic gene to alleviate the effects of agenetic disorder?An individual carries a disease-causing point mutation. Briefly describe four methods that can be used to identify this mutation.