Given the mRNA for a protein: 5'–CCGAACGAUGGGCUAUCCCUAACCGUUU --- 3' Write the amino acid sequence a. For the protein synthesized from this mRNA.
Q: AGGTATCGCAT is a sequence from the coding strand of a gene. What will bw the corresponding sequence…
A: The terms used in the question represents the molecules used during a gene expression. A gene is a…
Q: What MRNA sequence codes the tripeptide shown below (write code in direction of N-terminus to…
A: Peptides are present in all individuals which are living. Peptides play may functional roles in our…
Q: the function of the small ribosomal subunits is
A:
Q: Below is a sequence of mRNA. Use it to answer the questions below. 5' -…
A: The central dogma in both prokaryotic and eukaryotic cell consists of a series of steps including…
Q: Explain why the statement is correct. A section of the mRNA has a nucleotide sequence of…
A: mRNA A single stranded RNA which is copied from DNA and contains gene or information about specific…
Q: Name the enzyme responsible for binding of aminoacid to trna?
A: Ribonucleic acid (RNA) is a biomolecule that plays important role in coding, decoding, and…
Q: Given the following mRNA sequence: 5-AUCCCGUAUGCCCGGGAGCUAGCCCAGC-3 a) Label the first condon, the…
A: Transcription is a process through which the template DNA strand is transcribed into mRNA. mRNA…
Q: Use the chart below to find the correct amino acids for the following mRNA strand: GCUAUGUUU…
A: The process of producing protein by association of mRNA and ribosomes is called translation. The…
Q: The amino acids, in one-letter symbols and no spaces, coded by the following mRNA sequence is 5’…
A:
Q: the sequences od tRNA and corresponding mRNA is complementary to each other. is the statement true…
A: The synthesis of a functional protein involves two processes namely transcription and translation.…
Q: If there are 64 possible codons in the genetic code and the amino acid is specified by each, as read…
A: Protein synthesis is described as the process that ultimately results in the formation of proteins.…
Q: Explain how the genetic code stored within DNA determines the protein that will form
A: Proteins are the building blocks of cells and play crucial role in physiology due to the involvement…
Q: Describe the process of Translation of mRNA to DNA.
A: Ribonucleic acid (RNA) can be described as a chemical present in a wide range of living creatures,…
Q: Predict the sequence of amino acid coded by the mrna sequence 5’ GGA-GGC-ACA-UGG- GAA 3’
A: mRNA is read in 5' to 3' direction. Codons are triplet i.e. a combination of three bases codes for…
Q: An mRNA has the following sequence: 5' ACCAUGUACUGUCCUGCUGUUUGA 3'. Beginning from the start codon,…
A: In Amazon instant there are four type of nucleotide bases i.e adenine, guanine, cytosine and uracil.…
Q: A gene contains the sequence GGCTAAC. What is the sequence of the MRNA transcribed from this strand…
A: The method of producing an RNA copy of a gene sequence is known as transcription. This duplicate,…
Q: LIOCTOTmats Provide the three-letter amino acid sequence expected from each of the following mRNA…
A: Question - 1- Provide the three-letter amino acid sequence expected from each of the following mRNA…
Q: Give the initiation codon for protein synthesis. Name the amino acid it codes for?
A: A genetic codon is a three-nucleotide sequence of either DNA or RNA that corresponds to a particular…
Q: Three bases on MRNA that translate into an amino acid are called:
A: A translation is a process of conversion of mature mRNA molecules into long chains of a polypeptide…
Q: An mRNA has the following base sequence:5′–CAGGCGGCGAUGGACAAUAAAGCGGGCCUGUAAGC–3′Identify the start…
A: Hereditary qualities are a piece of science stressed over the examination of qualities, hereditary…
Q: If a sequence of bases on a DNA molecule is GATTACA, what would the complimentary mRNA strand look…
A: DNA replication is the process of the formation of identical copies of DNA.It occurs in nucleus.…
Q: The first codon in a mRNA will be ____ and will code for ___ and the final codon will be ______ and…
A: To synthesize protein molecules, a cell must first transfer information from DNA to mRNA through the…
Q: An mRNA molecule codifies only one type of protein?
A: mRNA (messenger RNA) molecules are also known as transcripts that carry the coding sequences for the…
Q: A non-coding DNA strand has the sequence below: GTACCGATATAATCGGGCTA What is the MRNA sequence that…
A: Noncoding DNA sequences are DNA sequences that do not encode protein sequences in an organism.…
Q: Using seven numbered steps, describe the process of translation.
A: Translation : It is the process of translating the sequence of mRNA molecule to a sequence of amino…
Q: Provide the abbreviation for the amino acid sequence expected from the following MRNA segment using…
A: Following amino acid sequence is predicted.
Q: What polypeptide is coded for by this mRNA sequence? 5'-GCU-GAA-GUC-GAG-GUG-UGG-3'
A: Codons are trinucleotide sequence (DNA, RNA) that codes for specific amino acid and chain of amino…
Q: Assume the following portion of an mRNA. Find a start signal, and writethe amino acid sequence that…
A: The process in which amino acid is incorporated into the polypeptide chain with the help of a…
Q: If a tRNA anticodon is CAA what is its corresponding mRNA codon? For the genetic code which amino…
A: Genes that provide instructions for proteins are expressed in a two-step process i.e., by…
Q: Write the amino acid sequence based on the following portion of MRNA. Write the name of the amino…
A: The codons which are present on mRNA are will code for specific amino acids based on genetic code…
Q: The tollowing mRNA transcript would result in which polypeptide sequence? 5'-ACU UUC ACU AUG UUU UUA…
A: Protein consists of amino acids linked by amide bonds or peptide bonds.
Q: Describe the process of Translation of MRNA to DNA.
A: Translation is the second phase of protein synthesis. It follows transcription, in which the…
Q: If the mRNA produced had the sequence ACGCGU, What would be the tRNA anticodon sequence?
A: mRNA is a messenger RNA that is synthesized from the DNA by the process called transcription. The…
Q: How many amino acids are coded for by the following mRNA: 5…
A: From the DNA, genetic information is transcribed in the form of codons. These codons reside in the…
Q: A scientist while sequencing mrna identifies the following strand…
A: Translation is the process by which polypeptides are synthesized from a mRNA transcript which is…
Q: How is the relationship between the tRNA and mRNA achieved?
A: Proteins are built from smaller units known as amino acids, that are fixed by three-nucleotide mRNA…
Q: Codon to be read in the mRNA is 5' GAA 3', what is the amino acid? a. E b. K c.F d.L
A: Dear student answer of your question is given below: Given codon in the mRNA is 5' GAA 3' , It…
Q: The mRNA formed from the repeating tetranucleotide UUACincorporates only three amino acids, but the…
A: Answer- According to the genetic code, all the 20 amino acids are coded by 64 set codons of…
Q: If methionine is the first amino acid incorporated into a heptapeptide, what is the sequenc of the…
A: Each group of three bases in a mRNA constitutes a codon. Each codon specifies an amino acid.
Q: If a DNA sequence , 3' TAC AAT GAA 5' , is the template for transcription, the resulting mRNA would…
A: CENTRAL DOGMA:- The whole process of Central Dogma involves two processes:- 1) When DNA changes into…
Q: An mRNA has the following sequence: 5′–GGCGAUGGGCAAUAAACCGGGCCAGUAAGC–3′ Identify the start codon,…
A: The central dogma describes the flow of genetic information. It states that genetic information in…
Q: if mRNA has a codon sequence of 5'-UAG-3', it will encode: Ieucine, no amino acide, methionine, a…
A: Translation is the process by which ribosomes in the cytoplasm or endoplasmic reticulum create…
Q: Translating mRNA C G A A U G C C G U A U U C G to amino acids
A: A codon is a trinucleotide sequence of DNA or RNA that corresponds to a specific amino acid.The…
Q: If MRNA has the bases UAU, what is the matching tRNA? O UAU O ATA O TUT O AUA
A: DNA(deoxyribonucleic acid) is the genetic material in all organisms except few viruses. The genetic…
Q: 6. [1] Given the DNA strand, GGACTGATT which of the following is its complementary mRNA? a CCTGACTAA…
A: Transcription Transcription is a process in which the DNA(deoxyribonucleic acid) is transcribed into…
Q: How many amino acids would there be in the protein produced from the following mRNA molecule ?…
A: 1. Stop codons- UAA, UAG and UGA. Codon consists of 3 nucleotides. There are 11 codons, but 10…
Q: Explain how an mRNA specifies the order of amino acids in apolypeptide
A: A gene is the essential physical and functional unit of heredity. They are comprised of DNA…
Q: Describe how the sequence of nucleotides in mRNA codes for the amino acids of a protein. How can the…
A: During the process of transcription the information from DNA is copied into mRNA for protein…
Please type your answer.
Step by step
Solved in 5 steps
- A part of an mRNA molecule with the sequence 5-UGC GCA-3 is being translated by a ribosome. The following activated tRNA molecules are available. tRNA Anticodon Amino Acid 3-GGC-5 Proline 3-CGU-5 Alanine 3-UGC-5 Treonine 3-CCG-5 Glycine 3-ACG-5 Cysteine 3-CGC-5 Alanine Which two of them can bind correctly to the mRNA so that a dipeptide can form? a. cysteinealanine b. prolinecysteine c. glycinecysteine d. alaninealanine e. threonineglycine1. b. What is the sequence of the mRNA produced from this gene? Label the 5' and 3' ends 5' GAGCCAUGCAUUAUCUAGAUAGUAGGCUCUGAGAAUUUAUCUC 3' 2. a. From 1b, draw the structure of the peptide.1 An Amino Acid Sequence Leu - Tyr - Gly-Gly - Val Which of the following changes to the mRNA that produces the amino acid sequence shown above would be characterized as a missense mutation? Select one: O A. CUC UAG GGU GGC GUA OB. CUC UAC GGG GGC GUA OC. CUC UAC GGU GGC GCU O D. CUC UAU GGU GGC GUA
- 3. Using your Genetic Code, translate and group the following mRNA bases. Example: UAC CAG UGG UUU CUA AUC Your Answer: AUG GUC ACC AAA GAU UAG Met – Val - Thr- Lys – Asp - Stop 5' CUCGGUACGUAAUAGAUCUAUCAUCC GAGACUCUUAAAU 3 b. 5' CUAAUAUUGUGAGAU 3'1. Given is the 30 nucleotides in the human gene for hemoglobin (the oxygen-carrying protein in the red blood cells): 3’ TAC-CAC-GTG-GAC-TGA-GGA-CTC-CTC-TTC-AGA 5’ a. What is the amino acid sequence based on this mRNA? b. A very important mutation in human hemoglobin occurs in this DNA sequence, where the T at nucleotide 20 is replace with an A. The mutant hemoglobin is called sickle cell hemoglobin and is associated with severe anemia. What is the amino acid replacement that results in sickle-cell hemoglobin?5’ AUG UUA CGU AAU GCU GUC GAA UCU AUU UGC UUU ACA UAA 3' Write the sequence of the DNA template (antisense) strand from which the mRNA was synthesized. Write the sequence of the DNA coding (sense or informational) strand complementary to the template strand. Write the sequence of tRNA anticodon that corresponds to the given mRNA molecule. Write the amino acid sequence of the peptide synthesized from the given mRNA nucleotide sequence.
- 3’ G G A U A C G U C A C C G G U A U A A G G U U U C G U A U C G 5’ If the RNA synthesized above is a functional mRNA and all the nucleotides belong to an exon, a. how many codons are present in this mRNA? b. how many codons actually code for a protein in this mRNA? c. what stop codon is present in this mRNA?Chrome ... x ← C Port A m ERNA F i t DESE a e d Use the codon table to determine which mRNA triplets code for the amino acid cysteine, Cys. Second mRNA base C A (5' 0 f COTON COCO с b CUA OG Course H U 000 UUU UUC UUA UUG CUU CUC CUG AUU AUA AUG Submit GUU mylabmastering.pearson.com/?courseid=12411621&key=28... ☆ GUC AUC lle UGG UGC UGU ACA AGU U 833 Phe Leu GUA n) GUG Select all that apply. Leu View Met or start Val UCU UCC UCA UCG CCU CCC CCA CCG ACU ACC ACA ACG GCU GCC GCA GCG 160 History Bookmarks Profiles Tab Window Help QuickLaun X Thr Request Answer Ser Pro Ala UAU UAC UAA Stop UAG Stop CAU CAC CAA CAG AAU AAC AAA AAG GAU GAC GAA GAG Tyr His Gin Asn Lys Asp Glu CGA UGU UGC UGA Stop A UGG Trp G CGU U CGC CGG AGU AGC AGA AGG GGU GGC GGA QuickLaury X G GGG Cys Arg Ser Arg Gly NOV 6 UT h CA A b a G U C G So OcO O COTON Right to be (3¹ X Gn) M (no subje x ☆出口口 **** 31 + U JO1. Using the genetic code, determine the sequence of amino acids encoded by the mRNA codocn sequence 5' GCC-AUG-GUA-AAA-UGC-GAC-CCC 3' 2. Using the genetic code, determine the sequence of amino acids encoded by the mRNA codocn sequence 5' CAU-CCU-CAC-ACU-GUU-UGU-UGG 3'
- a. Identify the type of mutation shown below. b. How many amino acids are affected? c. What type of impact will this mutation have on the functionality of the protein? Second Letter UAU Tyr UAC UUU UCU UGU UGC Phe Cys C UUC UUA UUG UCC UCA Ser UAA Stop UGA Stop A UAG Stop UGG Trp G Leu UCG CGU CAU His CCU C CCA G CUU CUC CAC CGC Leu CUA Arg Pro CGA CGG CAA Gin CUG CAG AUU AUC lle AUA AUG Met ACG ACU ACC ACA AAU Asn AAC The AAA AGU AGC Ser AGA AAG Lya AGG Arg GCU GCC GUU GAU GAC GAA GAG GGU GGC Gly Asp GUC Val GUA Ala GCA GCG GGA Glu GGG GUG ACC T C A G. G. 6. G G A C T. T. G. Original DNA strand G T A G. G. T. G. G. GA CT T. G. Mutated DNA strand First letter Third letter2. Given the mRNA for a protein: 5'-CCGAACGAUGGGCUAUCCCUAACCGUUU -- 3' Write the amino acid sequence a. For the protein synthesized from this mRNA. b. When U substitutes for C. substituted by U 5-CCGAACGAUGGGCUAUCCCUAACCGUUU-- 3 c. When C is deleted. deleted 5-CCGAACGAUGGGCUAUCCCUAACCGUUU --- 3' d. What type of mutation is illustrated in c?5' UGG CAA UCC UAC GAU 3' - 1. Here is the MRNA sequence from a section of a gene (it is the middle of the sequence, so it has no AUG). What is the template sequence of this gene? - 2. Are any of these codons in the MRNA non-degenerate? If so, indicate which one. e 3. 4 a) Translate this mRNA section. Give the 3 letter codes for the amino acids. b) Indicate on the peptide which is the C terminus and which is the N terminus. e 4. Is it possible for a single base pair substitution to cause a truncation in this peptide? If so, e explain how. e 5. Write out the sequence of the anticodon in the tRNA that would bind to the fourth codon in the e MRNA. e 6. Write out a possible miRNA that could regulate the expression of this gene
