An mRNA has the following sequence: 5' ACCAUGUACUGUCCUGCUGUUUGA 3'. Beginning from the start codon, what is the third amino acid of the translated polypeptide?

Q: The first three codons for a mRNA sequence are 5’ GGC AAG UCU 3', What anticodons will the correct…

A: * mRNA that is also called as messenger ribonucleic acid is a single stranded RNA corresponds to…

Q: Shown below is a codon in an mRNA. What is the correct sequence of the tRNA anticodon that…

A: The given messenger ribonucleic acid (mRNA) codon 5’-CAG-3’ codes for the amino acid glutamine.…

Q: An mRNA encodes a polypeptide that is 312 amino acids in length. The fifty-third codon in this…

A: The messenger ribonucleic acid (mRNA) is a molecule that synthesizes commands to produce products…

Q: During translation, a peptide is PRODUCED , while the MRNA is READ N-->C, 3-->5' 5'-->3'; N-->C.…

A: ANSWER;- N'-- C; 5'--3';

Q: Explain why the statement is correct. A section of the mRNA has a nucleotide sequence of…

A: mRNA  A single stranded RNA which is copied from DNA and contains gene or information about specific…

Q: A section of an mRNA has the following nucleotide sequence: ACU UGC AGU GGU GUA For the mRNA…

A:

Q: If the genetic code were overlapping, how many complete codons would the followingsequence encode…

A: The process by which mRNA is translated to the amino acid sequence is termed as translation. It…

Q: A segment in the middle of an mRNA has the sequence 5¿- AGAGAACCGCGA-3¿. Using the codon table,…

A: With the help of translation process protein forms. The nucleotide sequence are translated into…

Q: If the codon in the mRNA is 5' AUG', then the anticodon of the initiator tRNA is 5' CAT3' O 3' UAC5'…

A: CODON-  It is a unit of three nucleotides that forms a genetic code in a DNA/RNA.

Q: The anticodon 3’-CUG-5’ can base pair with which codon in mRNA?

A: Introduction :- A trinucleotide sequence at one end of a transfer RNA (tRNA) molecule that is…

Q: If the sequence of DNA on the template strand of a gene is AAA,the mRNA codon produced by…

A: Transcription is the process of formation of RNA using the DNA template strand. Both strands of a…

Q: When MRNAS are edited to become mature mRNA, the nonsense regions that are removed are called and…

A: Ribonucleic acid (RNA) is a significant organic macromolecule that is available in all natural…

Q: The first amino acid in a purified bacterial protein is methionine. The start codon in the mRNA is…

A: The process of protein(amino acid) formation is called translation and it is the last step of the…

Q: Which of the following codons is not a termination codon for protein synthesis?a) UUUb) UAGc) UAAd)…

A: UUU is not a termination codon for protein synthesis. Hence option a is the right answer UUU codes…

Q: An mRNA has the following base sequence:5′–CAGGCGGCGAUGGACAAUAAAGCGGGCCUGUAAGC–3′Identify the start…

A: Hereditary qualities are a piece of science stressed over the examination of qualities, hereditary…

Q: Which sequences are spliced out of the mRNA strand before leaving the nucleus?  In other words,…

A: Answer: TRANSCRIPTION : It is the process in central dogma where a DNA strand is transcribed in to…

Q: Consider the wobble rules listed in Table 15.2. An MRNA has the stop codon 5' UAA 3'. What TRNA…

A: Codon is a triplet of nucleotide base pairs.

Q: The first codon in a mRNA will be ____ and will code for ___ and the final codon will be ______ and…

A: To synthesize protein molecules, a cell must first transfer information from DNA to mRNA through the…

Q: In which reading frame will this mRNA be read? 5’- A C A G A U G C A A G U C U A A U G A C G - 3’…

A: Ans- b ) 2nd This mRNA will be read in the 2nd reading frame.

Q: For this RNA code, what is the final codon ? UACACGCCAGAGGUCGCCUUUACA

A: Introduction :- a DNA or RNA molecule that codes for a particular amino acid through a group of…

Q: When a codon in an mRNA with the sequence 5′-UAA-3′ enters the A site of a ribosome, it is not…

A: The process of reading the mRNA transcript to form proteins by joining the different amino acids…

Q: Translate the following mRNA into protein, starting from the first initiation codon:…

A: Translation is the process of synthesis of protein from an mRNA. mRNA synthesized through…

Q: An mRNA has the codon 5’ GUA 3’. What tRNA anticodon will bind to it?

A: The synthesis of polypeptide chains from mRNA is aided by translation. The ribosome (both ribosomal…

Q: A scientist sequencing mRNA identifies the following strand:…

A: mRNA is termed as messenger RNA. It is a single stranded RNA used in the synthesis of protein.mRNA…

Q: Refer to the codon diagram on. Which of the following is a codon that will terminate translation?*

A: A termination codon or a stop codon is a group of three amino acids that is present in the mRNA that…

Q: During the initiation of translation, the ribosome assembles on an mRNA strand with the start codon…

A: The process of polymerisation of amino acids from a polypeptide is known as translation. The…

Q: Follow the path of codons to discover the peptide and unlock the Directional Multilock. (Hint: type…

A: Peptide formed from given mRNA sequences.

Q: During transcription, a portion of mRNA is synthesized with the following base sequence.…

A: Introduction  Gene expression can only occur when the Gene is transcribed into mRNA and then this…

Q: Which of the following codons is called the start codon? a.UAA   b.UGA   c.UAG   d.AUG

A: The connection between the series of nucleotide on mRNA and series of amino acid in the polypeptide…

Q: What type of the mRNA is recognized as a first step of translation initiation in eukaryotes? a TaTA…

A: Translation is the process that results in protein synthesis. It takes place in the cytoplasm. This…

Q: How many amino acids are coded for by the following mRNA: 5…

A: From the DNA, genetic information is transcribed in the form of codons. These codons reside in the…

Q: When translation begins, the first amino acid heads to the small subunit of the ribosome.  What…

A: The translation is a process in molecular biology whereby the cell reads information from messenger…

Q: Explain the three steps (Codon recognition, peptide bond formation, translocation) in elongation…

A: The translation is the biological process that involves the conversion of the genetic information in…

Q: Which of the following codons in an MRNA can be recognized by the tRNA with UAA anticodon sequence…

A: A gene is a functioning heredity unit made up of DNA that provides instructions for the creation of…

Q: What amino acid sequence will be generated, based on the following MRNA codon sequence? 5' AUG- UCU-…

A: The genetic code is the precise sequence of DNA nucleotides interpreted as three-letter words or…

Q: An mRNA has the following sequence: 5′–GGCGAUGGGCAAUAAACCGGGCCAGUAAGC–3′ Identify the start codon,…

A: The central dogma describes the flow of genetic information. It states that genetic information in…

Q: if mRNA has a codon sequence of 5'-UAG-3', it will encode: Ieucine, no amino acide, methionine, a…

A: Translation is the process by which ribosomes in the cytoplasm or endoplasmic reticulum create…

Q: When the anticodon on a tRNA is "ICG, all of the following codons except can pair with this…

A: Some tRNA anticodon loops contain inosine (I) which allows recognition of multiple codons through…

Q: The first nucleotide in mRNA that will be synthesized from DNA below is:  3'-…

A: During the transcription process RNA is produced from the DNA within the nucleus of eukaryotic cells…

Q: Determine the mRNA sequence for the wild type polypeptide by identifying the codons that correspond…

A: Polypeptides are chain of amino acids which is bonded by the peptide bonds. It is coded from the…

Q: What codon is present near the 3′ 3end of all mRNA molecules?

A: Messenger RNA ( mRNA), this name was proposed by Jacob and Monod. It is always single stranded…

Q: If MRNA has the bases UAU, what is the matching tRNA? O UAU O ATA O TUT O AUA

A: DNA(deoxyribonucleic acid) is the genetic material in all organisms except few viruses. The genetic…

Q: Which of these features is found in eukaryotes but not bacteria?a. polygene mRNAs b. introns c. stop…

A: Living organisms are primarily classified as prokaryotes and eukaryotes. Prokaryotic organisms like…

Q: The following diagram illustrates a step in the process of translation. Identify the following…

A: Translation is the process of formation of protein from mRNA As in the question above start codon is…

Q: Given the mRNA for a protein: 5'–CCGAACGAUGGGCUAUCCCUAACCGUUU --- 3' Write the amino acid sequence…

A: DNA is the genetic material that gets transcribed into mRNA by an RNA polymerase enzyme. The…

Q: The following diagram illustrates a step in the process of translation. Identify the following…

A: The diagram illustrates the process of elongation of polypeptide chain by adding amino acids one by…

Q: Gene 1 TACTTGTTTACATAACTTTGAATT Step 1. Transcribe the DNA to MRNA Step 2. Draw lines to separate…

A: Genes are known as the hereditary units of life. They encode different proteins that are utilized to…

Q: An amino acid sequence reads:N—Met-Gln-Leu-Arg-Cys—C Write out one possible mRNA sequences with a…

A: The process by which mRNA is translated to the amino acid sequence is termed as translation. It…

Q: A polypeptide is composed of 4 amino acids. How many nucleotide bases on an mRNA strand are…

A: The relation between the sequence of nucleotides of messenger ribonucleic acid (mRNA) and the amino…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.