If the codon in the mRNA is 5' AUG', then the anticodon of the initiator tRNA is 5' CAT3' O 3' UAC5' 3' CAU5' O 3'TAC5

Q: Small ribosomal sub-unit MRNA Codon Large Ribosomal sub-unit Amino acid Anticodon A C. D. F Three…

A: Nucleus is main controller of the cell which carries genetic material . It also contain thread like…

Q: The anticodon of a tRNA is 5' AAU 3' a. What codon does the tRNA recognize? b. What amino acid does…

A: BASIC INFORMATION  TRANSLATION  It is the process through which the proteins are made with the…

Q: Termination of translation occurs when: a charged tRNA gets stuck in the E site release factor…

A: Translation is the mechanism which enables ribosomes in the cytoplasm or endoplasmic reticulum to…

Q: Codons are found on __________ and they contain __________ bases. a. tRNA, 4 b. mRNA, 3 c. tRNA, 3…

A: Codons are found on mRNA and they contain 3 bases. The genetic code is the stored genetic…

Q: A DNA codon of ATT is complementary to UAA this RNA codon. This codon terminates a coding region.…

A: Codon can be defined as the trinucleotide sequence of DNA or RNA which corresponds to a specific…

Q: A portion of a strand of a much longer molecule has a nucleotide sequence of AGCAGGCAGATC. During…

A: Translation, in molecular biology and genetics, is the mechanism by which ribosomes in the cytoplasm…

Q: The anticodon of a tRNA is 5' AAU 3' Part A What codon does the tRNA recognize? What amino acid does…

A: Transfer ribonucleic acid or tRNA is a small molecules which helps in translation of mRNA into…

Q: A tRNA molecule has the anticodon 5' AAG 3'. With which mRNA codon will this anticodon interact A…

A: A tRNA molecule act as a carrier molecule in the translation process where the trinucleotide…

Q: What is the anti-codon in tRNA that corresponds to the codon pGpCpA in MRNA? А. рТрGpC В. рСpGpT С.…

A: During replication and transcription a nucleic acid was copied from another nucleic acid. Hence this…

Q: Consider the wobble rules listed in Table 15.2. An MRNA has the stop codon 5' UAA 3'. What TRNA…

A: Codon is a triplet of nucleotide base pairs.

Q: An anticodon on a TRNA has the sequence 3' UAC 5. What amino acid would it be charged with?

A: The tRNA is the transfer ribonucleic acid and it helps to decode the information present in the mRNA…

Q: tRNA is released from the ribosome at the ________ site.

A: Ribosome is a macromolecular complex of rRNAs and ribosomal proteins; the site of protein synthesis.…

Q: An MRNA has the codon 5' GUA 3'. What tRNA anticodon will bind to it ? A) 5' CTA 31 B) 5' ATC 3' C)…

A: DNA replication is the process of formation of identical copies of DNA. It occurs in the nucleus of…

Q: Which amino acid is carried by the tRNA with the anticodon 5'-UCA-3'? None-this is a stop codon. OI.…

A: The process of translation helps in formation of long chains of amino acids ie, polynucleotides.  We…

Q: When a codon in an mRNA with the sequence 5′-UAA-3′ enters the A site of a ribosome, it is not…

A: The process of reading the mRNA transcript to form proteins by joining the different amino acids…

Q: During translation elongation, in which site do new tRNAs enter?   a) D site b) E site c) A site…

A: DNA => Transcription => mRNA => Translation => Protein. Protein synthesis ( ribosome…

Q: The anticodon loop of one of the t RNA Gly molecules from Escherichia coli is as follows: C--G G--C…

A: tRNA is a specialised RNA molecule that transports the amino acids during translation. A tRNA is…

Q: 1. A tRNA has the anticodon sequence: 5'-IGC- 3'. which codon will not decipher with this tRNA? a)…

A:

Q: An mRNA has the codon 5’ GUA 3’. What tRNA anticodon will bind to it?

A: The synthesis of polypeptide chains from mRNA is aided by translation. The ribosome (both ribosomal…

Q: During initiation of translation, a                                  is positioned first at the…

A: The translation is the process of synthesis of proteins that occurs on the ribosomes in the…

Q: A tRNA that has the anticodon GAG carries which amino acid?

A: tRNA is a special kind of RNA molecule. It is also called transfer RNA. tRNA or transfer RNA is…

Q: What will be the anticodon of the next tRNA added to the A site of the ribosome?

A: Codons are situated in on mRNA and anticodons are situated on tRNA.

Q: Below is a diagram of charged TRNAS in the active site of the ribosome during translation of the…

A: Each aminoacyl-tRNA synthetase's active site functions as a "lock and key" for an associated tRNA…

Q: Give the anticodon of the tRNA that would be a "wobble match" for the codon 5'AGG3'.

A: Messenger RNA (mRNA) carries the genetic information copied from DNA in the form of a series of…

Q: Assume that the nucleotide at the 5′ end of the first tRNA’s anticodon (the tRNA on the left) in…

A: The 61 codons codes code for 20 different amino acids. So, there must be 61  different tRNA…

Q: TRNAS contain the that interacts with MRNA. docking bay b. anticodon а. C. codon

A: A transfer RNA is an adaptor molecule made of RNA that is typically 76 to 90 nucleotides long (in…

Q: In bacterial mRNA, the initiating AUG codon is preceded several nucleotides away by a purine-rich…

A: Translation is the process by which a polypeptide is formed using an mRNA as its template.…

Q: For a TTT triplet of bases in the template sequence of DNA, the anticodon on the TRNA that binds the…

A: The anticodon is a trinucleotide sequence found on tRNA that controls which amino acid it…

Q: The tRNA binding site on the ribosome is called Select one: a. E site b. P site c. E P A

A: Ribosomes are membrane less cell components involved in the process of translation (protein…

Q: The 3 sites that bind tRNAs on a ribosome are on the A, P and E sites. How many sites can tRNA(s) be…

A: Translation is the formation of protein from mRNA. It occurs in cytoplasm of cell.

Q: AAG ATA CAG GCT CGG TAA For the DNA sequence shown above, identify the following: a. mRNA codons…

A: Introduction When DNA makes the same copy of itself then it is called replication. Each replicated…

Q: The tertiary structure of a tRNA is shown below. Using the various colored areas (i.e., red, yellow,…

A: Translation refers to the process of polymerisation of amino acid to form a polypeptide.the order…

Q: The following sequence represents triplets on DNA:TAC CAG ATA CAC TCC CCT GCG ACT a. Give the mRNA…

A: Hello, thank you for your question. The second part of the question seems to be incomplete,…

Q: Each tRNA has an _____ complementary to themRNA codon specifying the particular amino acid.?

A: Central Dogma of life is- DNA ---->mRNA -----> Protein The process of synthesis of a DNA…

Q: If the codon for Histidine is 5' CAU 3' in an MRNA molecule, the anticodon on the TRNA is: UAC ATG…

A: In every group of messenger ribonucleic acid (mRNA), there are three bases. A codon is also there…

Q: A series of tRNAs have the following anticodons. give all possible codons with which each tRNA can…

A: Anticodon relatable term with another term which is codon. A codon is a three-nucleotide stretch of…

Q: Which of the following codons in an MRNA can be recognized by the tRNA with UAA anticodon sequence…

A: A gene is a functioning heredity unit made up of DNA that provides instructions for the creation of…

Q: Choose the correct sequence for Translation process. 1. Translocation of the large subunit 2.…

A: Introduction :- The process of decoding the genetic code contained within a messenger RNA (mRNA)…

Q: The portion in the tRNA that is complementary with the mRNA when the aminoacyl-tRNA reaches the A…

A: tRNA means transfer RNA that carries the amino acid from the cytoplasmic pool to the site of protein…

Q: When the anticodon on a tRNA is "ICG, all of the following codons except can pair with this…

A: Some tRNA anticodon loops contain inosine (I) which allows recognition of multiple codons through…

Q: tRNAs contain the ________ that interacts with mRNA

A:

Q: The role of transfer RNA (tRNA) is to match a codon (3 bases) in mRNA sequence to:   A. An amino…

A: The process of protein synthesis is also known as translation. It is possible with the help of…

Q: The following diagram illustrates a step in the process of translation. Identify the following…

A: Translation is the process of formation of protein from mRNA As in the question above start codon is…

Q: The following diagram illustrates a step in the process of translation. Identify the following…

A: The diagram illustrates the process of elongation of polypeptide chain by adding amino acids one by…

Q: Gene 1 TACTTGTTTACATAACTTTGAATT Step 1. Transcribe the DNA to MRNA Step 2. Draw lines to separate…

A: Genes are known as the hereditary units of life. They encode different proteins that are utilized to…

Q: This type of mutation, where one nucleotide was replaced for another, is called a point mutation.…

A: DNA and RNA are are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid…

Q: CTA GCC CTC CGT TAC TAG TTA CCT ACT TAT TCA ATT TTG TAA ACG CTC ATC CGA ACC CGC TTT TAA TTG CCC ACT…

A: The process of synthesizing mRNA strand with the help of template stand of DNA is called…

Mitochondrial Mutations

A mitochondrion is a cellular organelle that serves as the site for cellular respiration and energy production (ATP or Adenosine Triphosphate). It is a double-membrane-bound organelle and is only present in eukaryotic cells.