"if there will be 124 amino acids to be coded by a polynomial tides in how many nucleotides are there in that polynucleotide chain"
Q: CH;OH H ÓH H H OH ČH,OH H ÓH
A: Polysaccharides are made of monosaccharide units linked together by glycosidic linkages.
Q: Give 3 similarities between the lock and key model and the induced fit model 2. Give 3 differences…
A: The main difference between the advertised balance and lock and the key model is that in the…
Q: Heating an enzyme makes it no longer function correctly because the heat: O A) removes phosphate…
A: Enzymes are highly specialized proteins that have extraordinary catalytic power, greater than that…
Q: commercial value associatiatef with glutamate Dehydrogenase? Propose your own ideas!
A: Glutamate dehydrogenase (GDH) is a hexameric enzyme that is it has six subunits and catalyzes the…
Q: Read each pair of sentences and then choose the letter of the correct answer. Your answer must be in…
A: Introduction: The malate-aspartate shuttle system is also known as the malate shuttle. It is an…
Q: After an MRNA primary transcript is created, a modified guanine nucleoside triphosphate is added to…
A: The flow of genetic information from DNA to RNA, RNA to protein synthesis is called central dogma.…
Q: how many atp can a palmitic acid yield from nadh?
A: A fatty acid is made up of a straight chain of an even number of carbon atoms with hydrogen atoms…
Q: Answer Briefly. 2.1 differentiate the forms of Vitamin E.
A: Vitamin E is one of the four fat soluble vitamin, the others are vitamin A, K and D.
Q: Consider the following statements: (1) the products of the first two stages of cholesterol…
A: In living organisms, biosynthesis is a multi-step enzyme-catalyzed process that converts simple…
Q: What is the active form of vitamin D, and how is it synthesized in humans?
A: Vitamin D is one of the fat-soluble vitamins. It has a structure similar to sterols and operates as…
Q: LAuden, halfan hour afler the dinner, comaining about 150g of carbohydrates 20gof f, and ag of…
A: Carbohydrates are the primary source of energy for the body. When there is energy demand in the…
Q: 1. Relate the chemical structure of an enzyme to its specificity and catalytic activity. 2. Design a…
A: A short answer would be : active site. Active site is responsible for the enzyme's catalytic…
Q: 6. Complete the table below. Anabolic Function Disorder/Disease due to hormone abnormal activity
A: The anabolic process in the body like protein synthesis and new tissue formation requires the action…
Q: Using the word anomeric carbon, “acceptor” nucleophilic substrate, and activated “donor”, describe…
A: In polysaccharides the monosaccharide units are linked by glycosidic linkages.
Q: What are the different solid phases that antibody or antigen can bind to,in ELISA? 8. What are the…
A: A solid phase enzyme-linked immunoabsorbent assay can be defined as quantitative immunological…
Q: 10. It was found that At coordinates to a metal in a 4:1 stoichiometry. Noting that A has a ba…
A: Biological important of coordination compounds like the heme group, which is Fe-Porphyrin complex…
Q: 11. How can you relate waterfalls to a mole of glucose? 12 What are the stens in catabolism?
A: Potential energy- Energy in stored form Kinetic energy- Energy when it gets released
Q: Show a(13:1)Cis Fatty-acid that is △^10 and what it is called in Omega No man clay.tur. Compared to…
A: Fatty acids are carboxylic acids with a hydrocarbon chain ranging from 4 carbon to 36 carbons. The…
Q: Which of the following is true? a. Non-Heme iron in plant foods is absorbed more efficiently than…
A: Heme iron and non heme iron are two sources of iron that comes from animals and plants. The source…
Q: Draw tyrosine metabolic pathway from glycolysis and Krebs cycle. Mark every carbon.
A: Glycolysis is metabolic pathway in which glucose (6 carbon molecule) breakdown into 3 carbon…
Q: In enzyme catalysed reactions, the energy level of the enzyme/substrate (or ES) complex is higher…
A: The enzyme is synthesized in the body and reactions are carried out in presence of enzymes. They are…
Q: 1. Indicate the effect of insulin and glucagon on the following metabolic processes. Write INCREASE…
A: Note : Hi ! Thank you for the question. We are authorized to answer one question at a time. Since…
Q: When glucose is oxidized by the body to generate energy, part of the energy is used to make…
A: Glucose is central to energy consumption and the catabolism of glucose remains the major source of…
Q: Nitrate reduction to nitrite is indicated by the formation of a pink to red colour after addition of…
A: Sulfanilic acid reacts with nitrous acid to form diazotized sulfanilic acid if introduced. This…
Q: BSA (mg/ml) Absorbancy 595nm 0.225 1 0.310 2 0.420 3 0.510 4 0.610 0.720 6 0.810 7 0.915 8 0.950…
A: The Bradford Assay is is a sensitive assay to detect and quantify protein in solution.
Q: The first global mass bleaching of corals occurred in
A: A coral reef is a submerged ecosystem characterised by corals that build reefs. Reefs are made up of…
Q: Provide the mechanism for step 2 of the biological formation of geranyl diphosphate (A') are…
A: Coupling of two Isopentenyl pyrophosphate molecules gives geranyl pyrophosphate or geranyl…
Q: exactly is meant by the term "homogeneous structure"
A: Homogenous in biological term refers to as common or similar.
Q: Red Blood Cells and anaerobic muscle produce pyruvate that is reduced to Write your response here…
A: Carbohydrate Metabolism: It is a biochemical process that where there is a constant supply of…
Q: Bubble boy disease is a deficiency in adenosine deaminase that results in the accumulation of DADP.…
A: Bubble boy disease also known as " SCID" i,e severe combined immunodeficiency, is named so because…
Q: 3. What are the enzymes involved in an irreversible reaction? How are these enzymes being activated?…
A: Enzymes are biological catalysts that are proteins. Chemical reactions are sped up by catalysts.…
Q: Which of the following is true? Group of answer choices All prokaryotes have a common genetic code,…
A: The amino acid sequence of proteins is determined by the sequence of nucleotides in deoxyribonucleic…
Q: The following figure depicts the breakdown of purine nucleotides, which are the nucleotides with…
A: Introduction: Uric acid is the end product of purine metabolism and is excreted by the kidneys. Gout…
Q: Read each pair of sentences and then CH in UPPERCASE. A. Both statements are true. B. The first…
A: Gibbs free energy is indicated by G and change in Gibbs free energy is denoted by ∆G. It tells…
Q: QUESTION 22 Mst digeston Hb*I Hb HDI HD Hb*I Hb E 1.35 kb E 1.16 kb Southern blot The figure above…
A: As indicated in the RFLP and restriction digestion analysis of the HbA and HbS gene there is a…
Q: fill in the blanks Complete metabolism of the fatty acid stearate will produce ( )…
A: metabolism of fatty acids consists of various metabolic processes involving or closely related to…
Q: Te ing Comme deptn pndat AiyiCoA Ceel c gae thpral nd Co Figure 10.2.2 Stages of Catabolism (Taken…
A: Kreb cycle/ citric acid cycle / tricarboxylic acid cycle is the common pathway of degraded complex…
Q: On average, 180 liters of plasma are filtered each day. A. If humans had to expend one molecule of…
A: Plasma is classified as the largest constituent that is present in the blood. It has a light…
Q: A proteinaceous molecule that catalyzes chemical reactions without being changed itself is known as…
A: The proteins are the polymers of amino acids. It is composed of an amino group, a carboxyl group, a…
Q: Imagine that you are working as a postdoctoral researcher in a laboratory that studies how heart…
A: Acyl-CoA dehydrogenases (ACADs) play key roles in the mitochondrial catabolism of fatty acids and…
Q: Name the carbohydrate and identify its classification (monosaccharides, disaccharides, or…
A: Carbohydrates are composed of carbon, hydrogen, and oxygen in the ratio of 1:2:1. Carbohydrates act…
Q: B14U A Goals n Skills Minds On Actio O Connect 2 Choose any two words in the table below, then…
A: Carbohydrates are the biomolecules that are classified as monosacharides, disaccharides and…
Q: The aldolase reaction cleaves fructose-1,6-bisphosphate to make G-3-P and DHAP. Draw the structures…
A: Aldolases are divided into two classes based on their reaction mechanism: class I and class II. The…
Q: After purifying alkaline phosphatase, you perform enzyme kinetic experiments with and without an…
A: Enzymes are protein molecules that increase the rate of reaction by decreasing the activation…
Q: Explain answer briefly but concisely 4. Which step in the glycolytic pathway would ensure that…
A: Glycolysis: Glucose - starting material and pyruvate- end product
Q: fill in the blanks The two enzymes in glycolysis that use ATP to perform substrate phosphorylation…
A: Substrate-level phosphorylation produces ATP or GTP by directly transferring a phosphate group from…
Q: Which of the following individuals would most benefit from a low sodium diet? O a. Joey is a 5 year…
A: Introduction: Sodium is considered to be one of the most abundant elements present on earth. Many of…
Q: What are the structural changes that occur in the uterus over the course of the menstrual cycle and…
A: The menstrual cycle is a sequence of natural modifications in hormone manufacturing and the systems…
Q: What factors in a population would mean that the Hardy-Weinberg principle does not apply?
A: Hardy-Weinberg principle states that, the allelic frequencies and genotypic frequencies in a…
Q: What is free energy? What is its symbol?
A: Enzymes are biocatalyst that increases the speed of reaction by lowering the activation energy.…
Gene Interactions
When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.
Gene Expression
Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.
"if there will be 124 amino acids to be coded by a polynomial tides in how many
Step by step
Solved in 3 steps
- The genetic code consists of a series of three-base wordsthat each code for a given amino acid.(a) Using the selections from the genetic code shown below, de-termine the amino acid sequence coded by the following seg-ment of RNA: UCCACAGCCUAUAUGGCAAACUUGAAG AUG= methionine ;CCU= proline; CAU= histidine ;UGG= tryptophan AAG= lysine ; UAU= tyrosine ;GCC= alanine ;UUG= leucine ;CGG= arginine ;UGU= cysteine ;AAC =asparagine ;ACA=threonine ;UCC= serine ;GCA=alanine ;UCA=serine(b) What is the complementary DNA sequence from which this RNA sequence was made? (c) If you were sequencing the DNA fragment in part (b), how many complementary chain pieces would you obtain in the tube containing ddATP?The genetic information contained in DNA consists of a linear sequence of coding units known as codons. Each codon consists of three adjacent DNA nucleotides that corresponto a single amino acid in a protien. The E.coli DNA molecule contains 4.70 x 10^6 base pairs. Determine the number of codons that can be present. Assuming that the average protein in E.coli consists of a chain of 400 amino acids, calculate the maximum number of protiens that can be coded by an E.coli DNA molecule.using, 3’ TGAGGCGCTAGGCCAAGCGGTAAGGATGCATGGTCGTGGTAG , What would be the resultant type of error on the amino acid chain?
- For the trinucleotide 5’ G-C-A-3’ How many nucleotide subunits are present in its ‘backbone’? How many nucleotide ‘non-backbone’ subunits are present? How many phosphodiester linkages are present? What is the overall charge carried by the trinucleotide?What is the length in AA’s of the LilP protein? Assume fMet is NOT CLEAVED. Write out the sequence of the polypeptide in AA: use the three letter notation, e.g. Met-Ser-Pro-For the m-RNA nucleotide codons given below, what is the corresponding sequence of amino acids? AUG UGU AUA UAU GUA AUC ACC UUC UAU GUA ACA UUU UGG AAC AGC UGC CAU GUA UAC CAG AAA CUU GCA GAG CUG GCU UUG AUA UGA The α-helices are known to contain primarily the amino acids methionine, alanine, leucine, glutamate, and lysine, while β-pleated sheets are known to primarily contain the amino acids tryptophan, tyrosine, phenylalanine, isoleucine, valine, and threonine. Which one of these two types of secondary protein structure is present with this amino acid sequence?
- Lactose permease, a protein of E. coli, is composed of a single polypeptide that is 417 amino acids in length. By convention, the amino acids within a polypeptide are numbered from the aminoterminus to the carboxyl-terminus. Are the following questions about lactose permease true or false? A. Because the 64th amino acid is glycine and the 68th amino acid is aspartic acid, the codon for glycine, 64, is closer to the 3′ end of the mRNA than the codon for aspartic acid, 68. B. The mRNA that encodes lactose permease must be greater than 1241 nucleotides in length.DNA molecules consist of chemically linked sequences of the bases adenine, guanine, cytosine, and thymine, denoted A, G, C, and T. A sequence of three basesiscalleda codon. A base may appear more than once in a codon. a) How many different codons are there? b) The bases A and G are purines, while C and T are pyrimidines. How many codons are there whose first and third bases are purines and whose second base is a pyrimidine? c) How many codons consist of three different bases?What are the sequences of all the possible tripeptides that contain the amino acids aspartic acid, leucine, and phenylalanine? Use the threeletter abbreviations to express your answer.
- What will be the order of amino acids derived from the following DNA sequence 5’-TGATCGCACAAT-3’? Explain briefly. (1.5) If the base G (denoted by an asterisk) in the sequence 5’-TGATCG*CACAAT-3’ is replaced by C due to a mutation, the new sequence will be 5’-TGATCCCACAAT-3’ what will be the new amino acid sequence? Explain briefly. (1.5) If the anticodon sequence of a tRNA is 5’-GCG-3’, what amino acid will it carry? Explain briefly. (1.5) What would be the effect of mutation if the C is changed to A in the anticodon? Explain briefly. (1.5)What kind of repeating polynucleotide would yield a single polypeptide with a tetrapeptide repeating unit?Insulin is synthesized as preproinsulin, which has 81 amino acids. How many heterocyclic bases must be present in the informational DNA strand to code for preproinsulin (assuming no introns are present)?