in Asignacion x What is the xE Untitled do x 234610#question-179879-49 Q O * * a O Dasaoo eO Siganente tabe,esponoe gonenepregona JARISSA I COLLADO ESPINAL Antibiotic Treatment Day Dosage % of Bacteria Surviving 1 300 mg 85% 300 mg 45% 3 300 mg 25% 4 300 mg 5% 10% 0 mg 20% 6 0 mg 45% 7 O mg DO 17 delete 888 F4 9 8 7 4. 2) R
Q: When in a cell cycle are the chromosomes actually replicated
A:
Q: _snRNP of the spliceosome recognizes to the 5' splice site through conventional base-pairing. These…
A: Splicing is a process that removes non coding sequence of genes from pre mRNA. Non coding sequence…
Q: The genetic description of an individual is its genotype, whereas the genetic description of a…
A: Introduction Genetics is the study of genes and heredity, or how specific attributes or traits are…
Q: Calculate the CFU/mL of the original culture for the countable plate as shown in the diagram. b) How…
A: Introduction :- CFU( colony forming units ) are the count of cells present in orginal culture which…
Q: How does the process of DNA replication generate mismatch mutations? What mechanisms are available…
A: DNA replication is the process in which dsDNA is copied to produce two identical DNA molecules.
Q: What is false about the image below? The cells are part of plant ground tissue B) The cells are…
A: * Ground tissue is all tissue in a plant include parenchyma and collenchyma and schlerenchyma. *…
Q: What seems to be the function of the spindle fibers ?
A: Spindle fibers are a network of threads like filaments that are forms during the cell division…
Q: Describe the most significant hormones responsible for sex differentiation. List the most important…
A:
Q: Aspartic acid has a side chain bearing a carboxylic acid group; its pK, is ~4. The alpha-carboxylic…
A: Aspartic acid have pka1 = 2.1 ( Alpha carboxylic) pka2 = 9.8 ( Alpha amino) pka3 = 3.9 ( side…
Q: How does cytokinesis differ in animals and plant cells?
A: The final stage in cell division in which the cytoplasm divides at the region between two newly…
Q: 1. You are observing an unknown vertebrate whose limbs are probably vestigial. What are the possible…
A: A limb is a jointed appendage in humans and numerous different animals use for locomotion like…
Q: n 2010, 150 coyotes (Canis latrans) were counted in Pierce County, WA. The population was surveyed…
A: Carrying capacity is defined as :-
Q: Select all examples of DNA transformation Check All That Apply Transfer of DNA through a pilus into…
A: The process through which an organism receives external DNA is known as transformation. There are…
Q: 4. The pre-mRNA encoded by the gene for calcitonin undergoes alternative processing to yield two…
A: Alternative splicing of precursor mRNA is an essential mechanism to increase the complexity of gene…
Q: Explain the concept of Making a Transgenic Animal: The Basics ?
A: The production of transgenic domesticated animals has the potential to significantly improve human…
Q: Gene therapy: a) what disease is it used for? b) what genetic defect causes the disease? c) what…
A: Since we only answer up to 3 sub-parts, we’ll answer the first 3. Please resubmit the question and…
Q: Which one of the following is not associated with transcription? * O sigma factor O hairpin loop…
A: Transcription is a process of making a RNA copy from sequence of DNA.
Q: Meiotic double strand breaks are repaired by SPO11. * True false
A: Meiotic recombination is the process of reciprocal exchange of genetic material (DNA) between the…
Q: 1. The is the side of the epithelial cell that faces the external environment or an internal…
A: According to guidelines we have to answer the first question only. so please kindly post the…
Q: Which strand below would be the complementary strand for the sequence AAACGCTT O GGGTATCC O AAGCGTTT…
A: A "nucleic acid" is a linear polymer of nucleotides that is a component of the cell's information…
Q: When is a tetrad specifically formed? Would it be found in a haploid or diploid cell? What event…
A: The "cell cycle", also known as "cell division", is a set of processes that occur in a cell leading…
Q: The most important piece of evidence missing from Darwin’s original hypothesis was:
A: There are some points about Darwinism : Provided evidence for scientific theory that all species…
Q: What important biological characteristics of life depend on mitotic cell division?
A: Cell division is a process that results in the development of two daughter cells is named Mitosis.…
Q: Consider a person without any functioning plasma cells. What effects would this condition have on…
A: Plasma cells are round or ovoid cells that contain colored cytoplasm with a pale perinuclear area of…
Q: with oxygen 2 ATP B convert energy 38 ATP Aerobic Respiration Anaerobic Respiration without oxygen
A: Aerobic respiration Process of the breakdown of macromolecules into small molecules for obtaining…
Q: The recognition sequence to which RNA polymerase binds at the initiation of transcription is found…
A: Ans- False The recognition sequence to which RNA polymerase binds at the initiation of transcription…
Q: Racoons have rings around their tails and a habit of washing their food in water before eating it.…
A: * Given that Wide bands on tails are BB Medium bands on tails are Bb Narrow bands are bb *Wash…
Q: Define about dideoxynucleotides (abbreviated ddNTPs) ?
A: The genome of an organism is defined as the entire genetic information that is passed down from…
Q: Define microevolution.
A: Introduction:- Evolution is the process of a species' features changing over numerous generations…
Q: 4. Why do you think is the classification of organisms important? 5. Do you personally agree with…
A: Introduction Biological classification refers to the process of arrangements of living organisms…
Q: •What the different columns in a cohort life table represent.
A:
Q: a thymine dimer formed after UV radiation would be best described as a base substitution a base…
A: Mutation is the change in DNA sequence. Mutations can occur due to exposure to ionising radiation or…
Q: er? TEalUNET ENED Hh Short Height: 25% 8. In flies, long wings (W) are dominant to short wings (w).…
A:
Q: 9. For stabilization of disturbed brain functions in mental disease nootropic agents are widely used…
A:
Q: 2. In the guinea pig, a locus controlling coat color may be occupied by any of 4 alleles with the…
A: Introduction : 4 alleles control coat colour of guinea pig Black = B Sepia = S Cream = C Albino…
Q: Reproduction is usually secual with both male and female sexes, however asexual reproduction does…
A: Parthenogenesis is the type of asexual reproduction involving the development of female gametes…
Q: Describe the ways in which each of the following pathogens can disarm their host’s immune system or…
A: There are a number of different ways of evading or subverting the immune response. These…
Q: Outline the differences among the three most sophisticated lungsfound in modern animals: the…
A: The insect tracheal system is not dependent on the circulatory system in order to get the oxygen…
Q: Which of the following muscles did he use?
A: Muscles are soft tissues. Many stretchy fibers make up muscles. Different types of muscles have…
Q: Explain why monarchs have different survival probabilities in species A and B
A: The monarch butterfly and natural milkweed plants have a symbiotic relationship. Monarch butterflies…
Q: Now consider alanine as a whole molecule. Use the Ka values from the chart above, and your…
A: For alanine, the pKa1 value is 2.35 the plan value is 9.87 The isolectric point is the pH at which…
Q: Explain the key to the Sanger technique ?
A: DNA is a molecule discovered in the nucleus by Friedrich Meischer in the late 1860s, but its…
Q: What is the following molecules not required for DNA synthesis during S- phase? * O RNA primer…
A: DNA replication is the process by which new DNA is synthesized from the old DNA. In case of…
Q: Splicing regulatory (SR) proteins bind at exon to recruit U1snRNP and U2 snRNP during RNA splicing.…
A: There are few important points about splicing apparatus are as follows: The central component of…
Q: In _______________ the selecting agent is the environment, whereas in _______________ the selecting…
A: Introduction Natural selection is the adaptation and modification of populations of living…
Q: What are some of the advantages and disadvantages of utilizing insects as experimental animals in…
A: Insects are one of most commonly used experimental model which helps in various ways in clinical and…
Q: Test Metabolic process indicated by a positive test. Citrate Indole Catalase Urease Methyl Red/…
A: Citrate test- are used to detect the use of citrate by an organism. Indole- it differentiates the…
Q: How SBS methods are useful for human genomes ?
A: One of the well-known states that are known as fundamental topics in Arithmetic is sequence and…
Q: the following data could the man be the father of the 3 children? please write complete answer and…
A: In a single cell, half genome is from father side while other half is from mother side.
Q: Gene 1 TACTTGTTTACATAACTTTGAATT Step 1. Transcribe the DNA to MRNA Step 2. Draw lines to separate…
A: Genes are known as the hereditary units of life. They encode different proteins that are utilized to…
Step by step
Solved in 2 steps
- C Clever Porta x dng To Do ady G Edote Q2 2021 SCLGB 2 M x A Did you finish your interim? if no X i edcite com/apps/MOElemiewer7assignid-nhaadmin_1611780315611&exid-nhaassessments 1571155631555&acode C6G7L7 2021_SCI_G8 12 MI12465/2 OF 25 Question 2- Notes C Line Guide Reset Answer Use the information below to answer the question. Complete the sentence below to describe the relationship between sunlight and the rubber tree. If sunlight was not an available resource to a rubber tree, this process would The Amazon rainforest is the world's largest rainforest, famous for its vast biodiversity. Rubber trees are one of the many organisms populating the forest. When the bark is peeled back, it reveals a white, milky sap known as latex which can be used for making rubber materials and waterproofing items. They also produce fruits which when dropped burst open upon ripeness to reveal the trees not - take place because it is a necessary component in the reaction. seeds Rubber tree fruit (above)…COVID-191 X My account X C Broward Pal x Opportunit X ZG Application x e ADN37-HX EHESI | Case X + sevier.com/#/content-player?assessmentVtwld-afcd4cb0-17dd-4437-82f1-ce5cb069ddf9&instanceld-bundle_2207609 ☆ b n.com - Onli... Imported From IE New Tab Other bo- Submit Question 8 of 24 Which instruction should the nurse give to the nursing student for positioning the client's legs when he is sitting? Use two pillows and place one lengthwise under each calf. Let him position himself with pillows until he is comfortable. Allow him to use the bed controls to markedly flex his knees. Encourage him to keep his legs flat and not bend his knees. Submit Question 9 of 249 X 11 My 11 My accoun: X *C C Broward Pax Opportunit x * ZG Session TX e AD HESI | Case X sevier.com/#/content-player?assessmentVtwld=afcd4cb0-17dd-4437-82f1-ce5cb069ddf9&instanceld-bundle_2207609 b n.com - Onli... New Tab Imported From IE Farmasion. (Enter the numerical value omy, in tounding is necessary, round to the rice tenth.) mL 1 Submit Lo Question 2 of 24 Before giving the initial dose of pain medication or antibiotic, which action should the nurse take first? Ask the client what liquid he would like to drink to swallow the pill. Teach the client the side effects of the medication. Ask the client if he is aware of any allergies to medications. Instruct the client to sit upright to swallow the medication. hp fg f5 Question 3 of 24 f6 J 17 - fe k fio fi ins delete
- HESI | Case X Question 7 of 24 COVID-19 V My account X X ZG Application X C Broward Pax e ADN37-HX Opportunit x ite.elsevier.com/#/content-player?assessmentVtwld=afcd4cb0-17dd-4437-82f1-ce5cb069ddf9&instanceld-bundle_2207609 b D Amazon.com - Onli... Imported From IE New Tab Oth Question 6 of 24 The nurse is observing a student nurse perform a peripheral assessment on the client. Which action requires the nurse to intervene? Palpating bilateral pedal pulses. Assessing the capillary refill in the great toe. Assessing the Homan's sign in bilateral extremities. Applying light pressure in ankles to determine edema. +A Test - Unit 2B F x E Practice -5. Ec x E Alya Alhashim x E Alya Alhashim x E Alya Alhashim x A examlogin.com/#/virtual_form/7c8d0e46-30d8-11ec-8b04-a772c9f594f9 Morris Bye Element.. Library Search Media services / Ele. E What's Going On in. 6 Bases housing U.S. 4 of 6 + 100% 18. A breeding pair of rabbits escaped from their cage behind a farmer's barn. The farmer observed the rabbits and.kept data on their population size for ten years. During this time, the rabbits reproduced and their offspring reproduced many times. The fenced, undisturbed two acres where the ribbits live support populations of predators, such as hawks and snakes, as well as a limited supply of grass and water. At the end of the ten years, the farmer graphed the data he collected. Which of the following graphs would its population growth look like? Don't pick E, you're welcome. A) E) Time Time D Time Time I am finished azis uoueindo azis uouejndo Population sizehttps://assignment.itslearning.ce X https://assignment.itslearning.c X .itslearning.com/mvc/Attachment/Get?Fileld=4rMyeCo2mEONWRK2cOFQzL2ygiD3VrOV2Au61%2fOZ%2f5to%2{6NE actice Problems and Homework_Dihybrid Cross Worksheet Dihybrid Practice Problems (1) Saved to itslearning it References Review View Help O Editing A A A 三、=、行 v 12 AaBbCc AaBbCc AaBbCc No Spacing x Aav 2 v A, 三、m、T Normal Heading 1 Paragraph smooth and white? Font Styles Two rough black guinea pigs when bred together have two offspring. One of them is rough white and the other is smooth black. What are the genotypes of these parents? 10. Parent 1 Parent 2
- Please help me answer letter e. Please! It would be best if your answer will be in a simplest form. Thank you so muchtions Slide Show Review View Shape Format 28 V A A" Ap 三 |2三v|= v v A Shape AV • Aa v D. Av 三==| 由。 Convert to SmartArt Picture Shapes Text Arrange Quick 2 Shape Box Styles Improvements, choose Check for Updates. Click to add title • Discuss the reasons why the problem of healthcare infections exist and, using named examples, discuss typical characteristics of microorganisms that are commonly associated with these types of infections. Contacts = Notes Comments MAY X MacBook Air 000 000 F4 F9 F10 F11 FS F6 F8 2$ % & 5 7 8I need help please labelling it
- OC PandaDoc google- Bing A https://app.pandadoc.com/document/f16b0aa2d65b2082587f3 cess, place your favorites here on the favorites bar. Manage favorites now daDoc Harrisburg Caregiver Application All changes have been saved Universal Precautions 1. Which one of the following would NOT spread communicable diseases? ANSWER: Dropdown a. Droplets from the nose and mouth b. The use of universal precautions c. Direct contact with feces (bowel movement) d. Open wounds that are draining blood 2. The major recommendation of universal precautions is to minimize contact with w of the following? ANSWER: Popdown a. Consumer's linen b. Consumer's personal beľongings c. Blood and body fluids d. Consumer's skin Handling of Emergencies 1. A direct care worker discovers a small fire in the wastebasket in a room where the cor is sitting. The direct care worker should FIRST: ANSWER: Click N fields th a. Call 911 You have 83 item(s) to fill in CENR crying, in pain, and holding their arm which is bent in…ning Gorilla Glass Q 4A C X M Illun x * VHL X O Nea x K! Play x O Pres x O 404 H Sign X SCL X W llun O Nea X b testing.illuminateed.com/assessment/60239b9beff909f8078b6468/603900d02afa0928088b4607/1?rldbqn=1 APBiology_S21_UE4A 6 The following are some of a cell. steps that take place when protein synthesis occurs in I. Amino acids bond together to form a polypeptide chain. II. A specific anti-codon on Transfer RNA bonds to a specific codon on Messenger RNA. III. Messenger RNA attaches to a ribosome. IV. Messenger RNA is produced using DNA as a template. Which of the following is the correct order of the steps shown above? F I, II, III, IV G II, III, I, Iv H IV, II, I, III J IV, III, II, I Рage 3 GO ON Illuminate Education TM Inc. acerI am confused what is HDI. pls define in easy words.