In ONE sentence define the function of the following 1. SSBS = The SSBS are single 2. Beta subunit of DNA polymerase III = The beta subunit is 3. DNA polymerase I = DNA polymerase li 4. Clamp loading protein = The clamp loading E
Q: From the list given - choose all the regulatory sequences that you thỉnk would control the expressio...
A: Introduction Gene expression in eukaryotic cells is regulated by repressors as well as by transcript...
Q: How does Salmonella typhimurium avoid being killed by phagocytes.
A: Salmonella manipulates inflammatory pathways and the autophagy process. Salmonella evades the adapt...
Q: What is the function of IFT?
A: IFT stands for Inter Ferential Therapy. It was discovered in the early's 1950. It is a very popular ...
Q: Exploring Further: The table below outlines the stpes in eukaryotic gene expressions. Briefly summar...
A: Gene expression steps molecules involved summary Transcription mRNA, small and large ribosomal...
Q: From the list given - choose all of the regulatory proteins that would bind the eukaryotic gene to c...
A: The transcription is the process that involves production of RNA from the DNA template. In case of e...
Q: A) Describe in as much detail as you can, the fluid mosaic model of a cellular membrane. B) What is ...
A: INTRODUCTION Fluid Mosaic model of cellular membrane The Fluid mosaic model of cell membrane was pro...
Q: Climate is the result of a variety of global processes. What of the following is a climatological dr...
A: Global warming is the long-term heating of Earth's climate system observed since the pre-industrial ...
Q: How do plants use their organs to fulfill essential functions?
A: In plants, different tissue work in coordination to make an organ that completes a particular functi...
Q: Why are cellular respiration and photosynthesis thought to be cyclical reaction? Think about the pro...
A: Introduction Cellular respiration is what cells do to break up sugars to get the energy they can use...
Q: hough one might think that disease alleles and other deleterious mutations would be eliminated from ...
A: Deleterious allele is the allele that is responsible for the development of some serious diseases wh...
Q: Contrast the role of the MCM1 protein in different yeastcell types shown in Figure 12-10. How are th...
A: Mcm1 is a multifunctional protein in Saccharomyces cerevisiae that has a role in both the commenceme...
Q: Compare the types of bacterial genes associated with inducible operons, those associated with repres...
A: Gene regulation is a collection of mechanisms that the cell employs to reduce or increase the produc...
Q: Who created the two-part naming system used in biology?
A: Carl Linnaeus, a Swedish naturalist, was the first to devise the scientific naming system that is st...
Q: calculate the rate of weight change over this 30-minute period Write your answer in standard notatio...
A: Introduction: Carbohydrates are produced by the green plants by the process of photosynthesis.They a...
Q: ______are members of the phytoplankton . a. Water molds c. Diatoms b. Giant kelps d. Cellular slime ...
A: The phytoplankton is too small to be seen individually with the naked eye. They are autotrophic comp...
Q: What analogies can you draw between transcriptionaltrans-acting factors that activate gene expressio...
A: Introduction Bacteria are common, largely free-living organisms that are often made up of only one b...
Q: How does iodine kill germs?
A: Introduction In this question we will discuss about how does iodine kill germs.
Q: explain transcriptional stages such as initiation, elongation, and termination. In this article, ple...
A:
Q: dye-linked substrate called X-gal (5-bromo-4-chloro-3-indolyl-ß-D-galacto-pyranoside) into galactose...
A: The lac operon contains a group of related genes (promoter, operator, Lac Z, Lac A, and lac Y) that ...
Q: Estimate the number of hominin species that have existed in both robust and gracile clades of evolut...
A: Researchers have narrowed down on the fact that based on the number of unearthed fossils, there were...
Q: What do you think are the things you have to consider when identifying plant tissues? With and Witho...
A: Plant tissue is a collection of cells that work together to perform a specific function in the plant...
Q: What is the molecular basis of dynamic instability?
A: Introduction: A microtubule is a tubular linear polymer of tubulin protein which is a part of the cy...
Q: 3. Cross a Red Rose and Pink Rose. The other phenotype for this type of Rose is white. What is the p...
A: Introduction: Incomplete dominance is a form of intermediate inheritance in which one allele for a s...
Q: What are the balanced chemical equations of breathing?
A: Introduction: Breathing is the process of inhaling air into the lungs and then exhaling it out of th...
Q: Disease occurred-How did the population growth curve with many predators compare the normal populati...
A: An ecosystem is a natural community of living beings that deals with the external environment and ot...
Q: What does the term Ultrasound mean in technical language to biologists?
A: Note: As per Bartleby Guidelines For Remaining Answers Please Repost The Question. Introduction: Bat...
Q: Retrotransposons are mediated by the enzyme O a. transposase O b. RISC O c retrotransposase O d. ret...
A: Retrotransposons move by a copy and paste mechanism. However transportions describe the copy is made...
Q: Discussions on crime and deviance suggest that biological explanations of crime are superior to all ...
A: Eugenic movement deals with the genetic construction of an individual. With the theory of Cesare L...
Q: Which of the following animals is a prosimian? a) lemur b)primates endemic to Madagascar c)an outgr...
A: Evolution is a continuous transition of living forms, beginning with the basic forms of the past and...
Q: I have provided everything needed please help me out
A: Given that, the dominant T allele is responsible for taste of phenylthiocarbamide. Let us consider, ...
Q: HOW each variable influence the distribution of different biomes and distribution of flora and fauna...
A: Ecosystem diversity refers to the different types of ecosystems occurring in an area. For example De...
Q: Explain about Nucleic Acid Blottin ? Why it is used?
A:
Q: Given the following organisms, create a simple cladogram and indicate the trait/s that separate/s th...
A: Cladogram Cladogram is a diagram that represent the relationship between different group of organis...
Q: In the absence of centrioles among the cells of higher plants, give one pole-based mechanism exhibit...
A: The "cell cycle", also known as "cell division", is a set of processes that occur in a cell leading ...
Q: The process of starts with a molecule of an output of pyruvate.
A: Cellular respiration is the process of breakdown of sugars into simple inorganic molecules to genera...
Q: the Effects of BPA on NFκB pathway
A: Bisphenol A (BPA) is a harmful endocrine disruptor that is found in polycarbonate plastics such as p...
Q: 2) Why was there a greater A260 absorbance reading for your DNA sample that was incubated at higher ...
A: 2. Why was there a greater A260 absorbance reading for your DNA sample that was incubated at higher ...
Q: Name the two (2) different varieties of Ginger and describe two (2) characteristics of each
A: * Zingiber officinale belongs to Zingiberaceae family is known as ginger. *Ginger a flowering plan...
Q: Scientists suggest a major evolutionary shift may have occurred when some human populations in east ...
A: Human evolution is defined as "the process by which humans evolved on Earth from now-extinct apes." ...
Q: Write a short note on Lichens. Also give classification of Lichens.
A: Lichens are the result of a symbiotic relationship between algae and fungi. The algae component is r...
Q: A is dominant over a and B is dominant over b. Genes A/a and B/b assort independently. The parental ...
A: AAbb X aaBB F1:- Ab Ab aB AaBb AaBb aB AaBb AaBb
Q: Influenza strains have hemaglutinins and neuraminidases on their cell surface. Briefly describe what...
A: Influenza virus is responsible for causing respiratory disease. Four types of influenza viruses are ...
Q: In humans, gene A is paternally imprinted. The paternal copy of the gene is methylated and not expre...
A: Given Family 1 Father's gene is not expressed in both dominant as well as in recessive condition. ...
Q: 1. provide three reasons why most of the research on carotenoids concentrates on b-carotene.
A: *NOTE: Kindly repost for other question Dear Student as per the guidelines we are supposed to answer...
Q: 1. Hypertrophic cardiomyopathy (HCM) is an inherited disease, characterized by severe chest pain, di...
A: In hypertrophic cardiomyopathy as the name suggest the ventricles undergo hypertrophy due to the fac...
Q: 1. Fill in the blanks with the terms in the list: antrum, corpus luteum, first polar body, Graafian,...
A: Gametes production in males is called spermatogenesis. Gametes production in females is called Oogen...
Q: Why is this statement false? Without the renal medullar osmotic gradient, you would not be able to r...
A: The main function of the nephrons of the Kidneys to form urine which is primarily made up of urea. N...
Q: If I were working with the fruit fly Drosophilaand want to determine whether a newly found character...
A: One of the methods that one can implement here is Test crossing. Test crossing is elaborate as follo...
Q: Archegonia 50 um
A: 1. young archegonium; 2. egg cell; 3. neck canal cells; 4. mature archegonium; 5. neck canal; 6. mat...
Q: Figure 1. The ecosystem structure and functioning are governed by at least five independent control ...
A: The combination of living organism along with the environment around them is termed to be the ecosys...
i need to do it one
Step by step
Solved in 2 steps
- Below is a sample of a segment of DNA…(copy from left to right) 3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’ 5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’ 1.Assume the 6th amino acid is changed from T to G on the DNA template strand. What type of mutation is this? What effect would this have on the protein? Look up an example for this type of mutation. 2, Assume the 5th and 6th amino acids are removed from the DNA template strand. What type of mutation is this? How would this affect the protein? Look up an example of this type of mutation. 3.Which mutation changes the protein more...a point mutation or a frameshift mutation. Explain your reasoning. 4.What would be the problem if ATT was inserted into the DNA template strand after the second codon? (Be sure to consult the coding chart for amino acids). 5. What if the second amino acid was repeated over 5Ox. What amino acid is repeated? What type of mutation is this? If this is on chromosome 4, what genetic disorder is this?…Match the enzyme on the left with its role in DNA replication DNA polymerase I helicase DNA ligase DNA polymerase III topoisomerase primase 72 W w# 3 E $ 4 R % 5 T A 6 MacBook Pro Y & 7 U * 8 replaces primers with DNA connects Okazaki fragments to form a continuous strand of DNA synthesizes short RNA fragments used to initiate DNA synthesis Uses the 3'OH of an RNA primer to synthesize the leading strand and Okazaki fragments keeps DNA from getting tangled up ahead of the replication fork "unwinds" the DNA double helix at the origin and replication forks 1 ( 9 X 0 0 P + 11 NextFor the following DNA sequence along a chromosome answer the following questions: The enzymes are working 5' ATGCATTAGACCACTAGCAT 3' left to right 3' TACGTAATCTGGTGATCGTA 5' 12. Is the top or bottom the leading strand? 13. On the leading strand only, start with a primer that is 5 nucleotide's long and then finish the rest as DNA polymerase would. Give me the entire strand of only the leading strand. 14. What enzyme copies the DNA by adding DNA nucleotides? 15. What enzyme links Okazaki fragments together on the lagging strand?
- this is the worst figure i have ever seen. Evidently A and B are different but the same color? From what I understand A would be a sliding clamp, and B is Primase? Is F rna primer (I think personally) or representing the SSBP? this is the worst diagram ever. the words that are for labeling are as follows: DNA polymerase III, sliding clamp, helicase, single-stranded binding protein (SSBPs), topoisomerase, RNA primer, newly synthesized DNA, primase, and DNA ligase.Which of the following statement(s) is/are false/incorrect? You may select multiple options, if necessary. ☐ Experiments support bidirectional movement of multiple replication forks at eukaryotic chromosomes. O Mg++ ions play important roles during DNA synthesis Synthesis of DNA is semi-conservative ✔ Beta clamp reduces DNA polymerase processivity ✔ DNA polymerase III uses ATP as a source of energy to drive the polymerization reaction forward O Tautomers enhance chances of correct nucleotide incorporation during DNA synthesisChoose reactions that always require hydrolysis of ATP. Select all that apply. sliding along template strands unwinding of DNA strands by helicase formation of the phosphodiester linkage by DNA ligase unwinding of DNA strands by B2 subunits formation of the phosphodiester linkage by DNA polymerase I
- Take each of the DNA sequences and complete ALL of the following steps: i. Find the DNA Replication Complement of each strand ii. Transcribe the complement strand of DNA into an mRNA strand Translate the mRNA strand into an Amino Acid strand iii. a. ATGGACGTATAGATGACAGGTAGATGTTTCAGGGGGATTTATCGATAG b. ATGGCCATTGAGTGTCAAAAGTCTCAATGA First base U UUU UUC UUA UUG CUU CUC C CUA CUG G U -phenylalanine (Phe) -leucine (Leu) GUU GUC GUA GUG leucine (Leu) AUU AUC isoleucine (lle) Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Second base ACU ACC AUA ACA AUG methionine (Met) (start) ACG -valine (Val) UCU UCC UCA UCG CCU CCC CCA CCG GCU GCC GCA GCG C -serine (Ser) -proline (Pro) -threonine (Thr) -alanine (Ala) UAU UAC UAA stop UAG stop CAU CAC CAA CAG AAU AAC AAA AAG A -tyrosine (Tyr) GAU GAC GAA GAG - histidine (His) -glutamine (Gln) - asparagine (Asn) -lysine (Lys) -aspartic acid (Asp) -glutamic acid (Glu) CGU CGC CGA CGG AGU AGC AGA AGG G -cysteine…For the following DNA sequence along a chromosome answer the following questions: The enzymes are working 5' ATGCATTAGACCACTAGCAT 3' left to right 3' TACGTAATCTGGTGATCGTA 5' 13. On the leading strand only, start with a primer that is 5 nucleotide's long and then finish the rest as DNA polymerase would. Give me the entire strand of only the leading strand.Match the enzyme or protein to the replication process. Record your answers onto the Google Form. a. DNA polymerase I b. DNA polymerase I| c. DNA polymerase III d. primase e. DNA ligase f. helicase 9. single-strand-binding proteins h. topoisomerase II 58. Unwinds helix and breaks hydrogen bonds to make a replication fork. 69. Removes RNA primer and replaces it with DNA nucleotides. 60. Joins together the fragments made on the lagging strand. 61. Adds a short segment of RNA to start replication. 62. Stabilizes newly unwound strands. 63. Catalyzes the addition of new nucleotides, one at a time. 64. Relieves strain of over winding created by replication fork. 65. Proofreads new nucleotide sequence for correctness.
- The X's correspond to the missing information. You need to determine what those X's represent DNA STRAND: XXX-CCC-GGG-GCG-XXX-XXX-XXX-GCC-ATA-TTA-XXX RNA STRAND: XXX-XXX-XXX-XXX-XXX-XXX-XXX-XXX-XXX-XXX-XXX PROTEIN: Met - X - X-X - Thr - Val - Glu-X-X-X - Trp To be clear, your answer is just the 3 sequences above without the X's (the highlighted yellow parts). There may be more than 1 correct answer for some parts of this assignment. Any answer your choose is fine. If you are unclear on how there could be more than 1 correct answer, review the lecture related to protein translation. Provide me with the: 1. Complete DNA sequence of 33 nucleotides 2. Complete RNA sequence of 33 nucleotides 3. 11 amino acidsBelow is a picture of a single origin of replication in a eukaryotic cell. 5' 3' 5' 1. On the figure above, Draw out where the following molecules will be located: Helicase; Sliding Clamp, Single Strand Binding Protein. 2. On the right hand side of the dotted line, the replication of which template strand (top or bottom) will be continuous by DNA polymerase? 3. On the left hand side of the dotted line, the complete replication of which template strand (top or bottom) will be more affected by a mutation that causes DNA ligase to be partially functional?What is/are the attributes that make nucleotide excision repair (NER) and base excision repair (BER) similar and/or different from each other? Select the correct response: The NER pathway is the only one that can remove DNA lesions in the strand regardless of their size which is followed by attaching the correct strand, then sealed by a DNA ligase. They both use the enzyme DNA glycosylases that recognizes the damaged DNA segments and proceed with repairing the faulty base in the strand. They differ NER only repairs purine bases while BER repairs pyrimidine bases. They both remove the damaged parts of the DNA where the BER pathway corrects only the identified damaged bases which are usually non-bulky lesions. The NER pathway, on the other hand, repairs the damage by removal of bulky DNA adducts which is a short-single stranded DNA segment. They both utilize the enzyme photolyase to reverse the damages created by the faulty section of the DNA. They both remove the damaged parts of the…
