Kha Vu Danels Include: 8DX : Safehy Jor bromie tnto lab repart! Name Section date sheet MAPPING PRACTICE #1 Below is a restriction map for the plasmid PGEN 101 (total length = 20 Kb). Using this map as a guide, give the number of restriction fraqments along with their associated lengths that would result from digesting PGEN 101 with the restriction enzymes EcoRI, BamHI and a combination of ECORI and BamHI. BamHI 3.2 Kb 1.7 Kb EcoRI BamHI PGEN 101 8.7 Kb 5.5 Kb .9 Kb EcoRI ECORI DIGESTION PERFORMED SIZES OF FRAGMENTS OBTAINED 10.4 kb , 0.9kb, 8.7 Kb EcoRI 3.2 Kb, 16. 8kb BamHI EcoRI + BamHI

Kha Vu Danels Include: 8DX : Safehy Jor bromie tnto lab repart! Name Section date sheet MAPPING PRACTICE #1 Below is a restriction map for the plasmid PGEN 101 (total length = 20 Kb). Using this map as a guide, give the number of restriction fraqments along with their associated lengths that would result from digesting PGEN 101 with the restriction enzymes EcoRI, BamHI and a combination of ECORI and BamHI. BamHI 3.2 Kb 1.7 Kb EcoRI BamHI PGEN 101 8.7 Kb 5.5 Kb .9 Kb EcoRI ECORI DIGESTION PERFORMED SIZES OF FRAGMENTS OBTAINED 10.4 kb , 0.9kb, 8.7 Kb EcoRI 3.2 Kb, 16. 8kb BamHI EcoRI + BamHI

Human Anatomy & Physiology (11th Edition)

11th Edition

ISBN:9780134580999

Author:Elaine N. Marieb, Katja N. Hoehn

Publisher:Elaine N. Marieb, Katja N. Hoehn

Chapter1: The Human Body: An Orientation

Section: Chapter Questions

Problem 1RQ: The correct sequence of levels forming the structural hierarchy is A. (a) organ, organ system,...

See similar textbooks

Similar questions

ull rain LTE 11:53 © 1 0 A 10% Done #1 Mol Bio Restriction Analysi... Complete the following problems. Restriction enzymes (REs), which cut D NA at specific sequences, are classic tools in molecular biology. Because of their specificity in cutting DNA, REs can be used to "map" DNA sequences by analyzing the fragments generated upon restriction digest, as in the example shown in Figure 1. Your task is to study the circular plasmid, pMBBS, through restriction digests. You subjected the PMBBS plasmid to complete digestion by different combinations of three REs (EcoRI, BamHI, and Xhol), and analyzed the results on an agarose gel, shown below. Using the data you can glean from this gel, answer the questions that follow. EcoRI BamHI Xhol DNA size ladder 600 bp 500 bp 400 bp 300 bp 200 bp 100 bp VC 100bp Plus DNA ladder from Vivantis Technologies *The same total amount of DNA was loaded in each lane. 1. What is the total size of the PMBBS plasmid in bp? Answer: bp 2. How many cut sites on the…
Section Name MAPPING PRACTICE #4 Plasmid pBR 607 is a 2.6 Kb plasmid containing Ampicillin and Tetracycline resistance markers, an origin of replication, and unique restriction sites for the restriction enzymes EcoRI, BamHI, and Pstl. Given the restriction map for pBR 607 for the enzymes EcoRI, BamHI, and Pstl, show on the gel diagram, where the approximate positions of the restriction fragments generated from the restriction digests would be located after carrying out electrophoresis. BamHI 0.2 Kb pBR 607 ECORI 1.94 Kb 0.46 Kb Pstl Size EcoRI EcoRI EcoRI + Standards BamHI + Pstl BamHI Pstl 4.0 Kb 2.2 Kb 2.0 Kb 0.5 Kb
I-Assume that a circular plasmid is 3200 base pairs in length and has restriction sites for HindIII restriction enzyme at the following locations: 400, 700, 1400, 2600. Give the expected sizes of the restriction fragments following complete digestion.
PCHEM4321. An agarose gel electrophoresis pattern of the plasmid PSPM4321 digestion (restriction) is shown below. Draw a restriction map of a plasmid with the appropriate restriction sites based on the data given below. Hindlll Hindll BamHI +BamHI Figure 1: 1% agarose gel electrophoresis of pCHEM4321 40 24 16 12 12 8 4 4 + |
A cloning vector map is shown below. EcoRI Bam Ban Hind P-galactosidase Amp Bam Bam EcoRI Ori C Which restriction site is best for inserting a DNA fragment for selection of chimeric plasmid containing colonies? 1) They're all equally good. 2) Hindll 3) EcoRI 4) BamHI
Help Please Supercoiled DNA migrates through an agorose gel faster than similarly sized linear DNA? True or False? Using the plasmid map, indicate where (bp region on plasmid) these enzymes cut on the plasmid. EcoR1 1. 1 Hindlll 2. 637 Bpu101 3. 14 BamHI 4. 256 To sequence a DNA plasmid, you need 1 µg of DNA. If your DNA concentration was 0.45 µg/µL. How many µl of your DNA 0.45 µg/µL is required to get 1 µg final? Answer in µl using 2 decimal places. Your Answer: Answer units >
Alu 1 EcoRI ori pKY Bgl I Tet: Tetracycline resistance gene A. What would be the donor organism to be used in this cloning? B. How would you make sure you only get your gene of interest (EGF) from donor but nothing else? C. How do you put EGF gene into pKY plasmid? What is the best RE to use when inserting the gene into pKY plasmid? What happens if you use the enzyme Bgl I to insert the gene of interest? How does it affect your cloning result? D. How do you make sure you only grow E.coli that have the gene of interest?
Competent E. coli cells were transformed with the pGLO plasmid. These transformed cells were then allowed to grow on two different plates: 1) a plate containing LB/AMP and 2) another plate containing LB/AMP/ARA. In which plate would you observe both phenotypic and genotypic changes? Briefly justify your answer. Edit View Insert Format Tools Table 12pt v Paragraph v BIUA e T?v 田 D2
#2 EcoRI --- 5’ G ↓AATTC 3’ 5’ ACG ACGTATTAGAATTCTTA TCCGCCGCCGGAATTCT CATCA 3’ 3’ TGC TGCATAATCTTAAGAATAGGCGGCGGCCTTAAGAGTAGT 5’ Restriction enzyme: Recognition sequence: Number of pieces of DNA: Type of cut:
You wish to insert a gene in the plasmid below. (Note the neon green lines represent restriction sites.) amp gene BamHI Sacl Saçl EcoRI BamHI 33 BamHI Gene of interest Chromosomal DNA from human cells a) Which restriction enzyme should you use to cleave the plasmid? Explain your answer. b) How would you create a cDNA library for the chromosomal DNA containing the gene of interest? c) The green area on the plasmid is the ampicillin resistance gene. Explain how you would use it to screen for a recombinant plasmid. 1
#4 BamI --- 5’ CCTAG ↓G 3’ 5’ ACGCCTAGGACGTATTATCCTAGGTAT CCGCCGCCGT CATCA 3’ 3’ TGCGGATCCTGCATAATAGGATCCATAGGCGGCGGCAGTAGT 5’ Restriction enzyme: Recognition sequence: Number of pieces of DNA: Type of cut:
Kpnl 4. Plasmid Z has a size of 7 kb, and the map shows Kpnl (K) and Pstl (P) cut sites relative to each other. This plasmid was digested with three different restriction enzymes 2000 bp 3500 bp Kpnl (K), Pstl (P) and Bgll (B) either alone or in combination and the samples run on an agarose gel as shown below. Where does Bgll (B) cut this plasmid ? Does the plasmid have one recognition site or two for Bg|l? Describe the Bgll cut site in this plasmid relative to the Kpnl cut Plasmid Z -7 kb Pstl site. How many bases to the left or right of the Kpnl cut site would you observe the Bgll cut site. Explain briefly. 1500 bp Pstl Ladder Kpni Psti K/P Bgl K/B KPB 7000 bp 7000 bp 5600 bp 5500 bp 4900 bp 3500 bp 2000 bp 1500 bp 1500 bp 1500 bp 1400 bp 600 bp %3D