MATCH THE FOLLOWING by putting a checkmark. TOPIC: TYPE OF INTERACTIONS. HIGH SCHOOL BIOLOGY GIVEN Adaptation Clumped Uniform distribution distribution Mutualism Competition Parasitism overlapping 1a. ranges 1b. Balanus and Cthalamus have 1c. Pisaster ochraceus is a species of sea star that serves as a keystone species in its native habitat The Philippine tarsier is a nocturnal animal Nutrient Trophic Cycling Interaction
Q: 5. The enzyme that can connect two DNA fragments into one is called: A. DNA polymerase B. DNA ligase…
A: The given question ask about enzyme which is used to join DNA fragments. Second question is about…
Q: Ch. 8: Which of the following is NOT a benign condition of the reproductive system a) mastitis b)…
A: Among the given options, the correct answer can be identified as follows- C) Uterine cancer Here,…
Q: During the lytic replication cycle of the bacteriophage T4, the phage _________ remains outside the…
A: A virus infects a cell, duplicates new virus particles, and then leaves the cell through the…
Q: energy used during the chemiosmotic synthesis of ATP in both mitochondria and chloroplasts es…
A: Chemiosmotic model was explained by Peter Mitchell. This is applied not only to mitochondrial…
Q: The diploid number of chromosomes in a cell of a domestic cat is 38. The table below shows the…
A: The interphase, a non-diverging phase, is composed of the G1, S1, and G2 phases in that order. While…
Q: Ch. 5: The condition which results from insufficient production of surfactant and the resulting…
A: Pneumothorax is a condition in which air or gas builds up between the lung and chest wall, causing…
Q: Short Answer 4. You identify two recessive mutations in fruit flies, one that results in curly wings…
A: We must take into account two characteristics of fruit flies, namely body colour and wing type.…
Q: The following is FALSE about actin polymerization: a. F-actin with ADP bound is removed from the end…
A: Introduction:- The network of protein filaments inside the cytosol of eukaryotic cells is known as…
Q: Which of the following are associated with the autonomic nervous system? L O both parasympathetic…
A: The peripheral nervous system's autonomic nervous system controls physiological functions that are…
Q: Ch. 6: The laboratory sends you these ABG results for your patient: pH 7.32, PaCO2 40 mmHg, and…
A: INTRODUCTION ABG Analysis This is arterial blood gas analysis. It measure the amount of arterial…
Q: Which of the following statements about vaccines is NOT correct? Smallpox vaccinations are no longer…
A: The term vaccine is associated with a substance that is given to a person to boost their immune…
Q: A researcher who studies bilogical memrbanes wanted to know the diffusion constant of phospholipids…
A: "Permeability signifies the ease with which a molecule can pass through a cell membrane." One of the…
Q: Is human salivary alpha amylase under covalent modification.?
A: Enzymes are "biological catalysts", the majority of enzymes are proteins, and enzymes, like other…
Q: Based on the following data, which bacteria is most likely a human pathogen? Bacteria E.coli S.…
A: Staphylococcus marcescens (S. marcescens) is a type of bacteria that can cause human illness and is…
Q: 2. Energy flow is a central theme throughout the study of environmental science. Consider energy…
A: Introduction:- Ecosystem is defined as a functional unit in ecology, in which biotic and abiotic…
Q: The hemoglobin protein has quaternary structure. This means that hemoglobin Selected answer will be…
A: Hemoglobin is the oligomeric protein,which contains heme as prosthetic group. Hemoglobin is…
Q: Cohesin proteins function as ______, and are most likely degraded during the early steps of…
A: Cohesin is a multisubunit protein complex. They are necessary for the cohesion between sister…
Q: Plants only give off oxygen and never require it. True False
A: Photosynthesis is a process used by plants and other organisms to convert light energy, usually from…
Q: 8) Where is potassium mostly found? A) in the extracellular fluid B) in the intracellular fluid…
A: Potassium is naturally found in foods and play an important role in body by maintaining normal…
Q: G) What is the total number of observed recombinants in consequence of double crossover? H) What…
A: Total number of observed recombinants are (80+72+6+4)= 162 offsprings. In which result of double…
Q: Ch. 5: Inflammation of the lung, triggered by infectious microbes or aspirated substances or smoke,…
A: Introduction Respiratory disorders affect the lungs of the patient and it leads to difficulties in…
Q: B-cells participate in _______ immunity and produce ________ a. acquired, proteasome…
A: Immunity mediated by humor is mediated by B lymphocytes. The B cell transforms into a plasma cell,…
Q: Which of the following will be found is found in mice cells and prokaryotic cells Select one: O a.…
A: Cells are the structural units of living beings. Each organism is composed of one or more cells.
Q: The human phenotype is regulated by epigenetic control of gene expression. Discuss the three main…
A: Control of gene expression is the process by which cells regulate the production of proteins and…
Q: Describe characteristics of Proteus Vulgaris in the Agar: Blood Agar MacConkey Agar EMB PEA Mannitol…
A: Non-human bacteria, viruses, and fungi outweigh human cells, making our body a home and source for a…
Q: 10. Which statement is true about gene transcription? A. Every gene that is present in the genome is…
A: Introduction: Transcription, is the process of the making an RNA copy of a gene's present on DNA…
Q: Why are SNPs beneficial over SSRs for getting a more precise location of a gene of interest? Select…
A: Studies demonstrate that SSRs are the marker of choice for parentage and assignment investigations…
Q: As humans age, the rate of cell division _____, which is intended to _______. Select one: a.…
A:
Q: What type of error will occur if starch is added too early in the Winkler analysis? A. Positive…
A: Starch is a type of carbohydrate found in many foods, including grains, potatoes, corn and rice. It…
Q: explain the mechanism by which acid growth happens. Why is acid growth important for plants?
A: The expansion dynamics of cells and organs in plants are explained by the acid-growth hypothesis.…
Q: Which of the following represents the fraction of carrying capacity remaining after a certain number…
A: What is carrying capacity? The carrying capacity of a population is the maximum number of…
Q: A primary care provider has diagnosed an elderly with Malaria. Explain what pathogen responsible…
A: Humans and other animals can contract malaria, an infectious disease spread by mosquitoes. Only…
Q: The overall goal of chemiosmosis is to make Select one: O a. NADH, Kreb's Cycle O b. NADPH, Calvin…
A: Introduction : The electron transport system/chain, or ETS/C, is the metabolic mechanism of…
Q: In case of starvation ie complete absence of glucose __ can be used to alternatively fuel the brain…
A: Most tissues use fatty acids and/or ketone bodies to conserve glucose for the brain during fasting.…
Q: In a healthy cell, which of the following proteins will be activated in order to suppress cell…
A: This protein controls cell division by acting as a tumor suppressor, which means that it prevents…
Q: What proteins might accumulate when proteins begin to denature during stress? Select one: a.…
A: The three dimensional structure of protein is essential for the protein to function. Denaturation is…
Q: Table 1. Average turgor loss point, stem hydraulic conductivity and plant water use efficiency for…
A: The average turgor loss point (TLP) is the point at which a plant cell loses its turgor pressure and…
Q: Describe how alterations in bacterial genes can be beneficial and harmful to humans. Include ONE…
A: Bacterial DNA is the genetic material that makes up bacterial cells. It contains all of the…
Q: please Describe the data in Figure 2. Figure 2. Pre-dawn and midday leaf water potential (Ψleaf)…
A: Introduction:- The molecules are transported across the cell membrane through various ways, - simple…
Q: In a hypothetical bug population, color is determined by a single gene and black is dominant over…
A: In the absence of disrupting influences, the population will have the same constant genetic…
Q: pH indicator
A: If an organism can hydrolyse esculin in the presence of bile, it gives positive bile esculin test. A…
Q: When can we say that HIV has progressed to the stage of AIDS? List several signs and explain why…
A: HIV or the Humans Immunodeficiency Virus is a virus that affects the immune system of individuals…
Q: Short Answer 3. The pedigree shown is of a family with an X-linked recessive disease. The sex…
A: A. Nondisjunction can happen during the anaphase of mitosis, meiosis I, or meiosis II. Sister…
Q: Some drugs may reduce DNA methylation at the promoter of the reelin gene. What is the likely impact…
A: Introduction: A protein called reelin is produced using instructions from the RELN gene. Both…
Q: Plant B grows in unstable soil, it also needs to grow rather tall and grow quickly. This results in…
A: Roots are the most important part of a plant it grow under the ground and take water and food from…
Q: We now have at least three SARS-CoV-2/COVID-19 vaccines approved by the FDA for use in the United…
A: The vaccines are: 1. Pfizer-BioNTech – Authorized on December 11, 2020 2. Moderna – Authorized on…
Q: Plant hormones
A: Introduction: Plants need a lot of natural support for their existence and growth, including water,…
Q: Consider the sequence below for amplification: GGCGTAGGCTGATCGTGGGCTCTAGGGGGCTGCTGCTGCTATTATGCTGGC…
A: The polymerase chain reaction (PCR) is a molecular biology technique to amplify a DNA segment of…
Q: What is templating?
A: Templating is a process that uses an existing biological structure as a template to create new…
Q: Ch. 7: Which of the following is FALSE about Wilms tumor? a) it is a genetic condition, often…
A: Introduction: A kind of juvenile cancer termed a wilms tumour originates in the kidneys. That is…
Answer all by putting a checkmark on the table
MATCHING TYPE:
Topic: TYPE OF INTERACTION
Step by step
Solved in 2 steps with 1 images
- what is the best research objectives for this research title? please enumerate Distribution of Vectors of Zoonotic diseases in animals in Iligan CityClassify the ff. parasites as to: A. food-borne B- water- borne C- can be both food and water borne D- soil transmitted E- arthropod transmitted parasites 1. Echinostoma ilocanum2. Cryptosporidium parvum3. Hookworm4. Trichuris trichiura5. Trichinella spiralis6. Anisakis spp.7. Giardia lamblia8. Ascaris lumbricoides9. Strongyloides stercoralis10. Taenia soliumClassify the ff. parasites as to: A. food-borne B- water- borne C- can be both food and water borne D- soil transmitted E- arthropod transmitted parasites 1. Echinostoma ilocanum2. Cryptosporidium parvum3. Hookworm4. Trichuris trichiura5. Trichinella spiralis6. Anisakis spp.7. Giardia lamblia8. Ascaris lumbricoides9. Strongyloides stercoralis10. Taenia solium No need to explain
- 84. The microbiology section of a tertiary hospital in the Cordillera Administrative Region was deputized toconduct routine testing and reporting of methicillin-resistant Staphylococcus aureus for the whole North Luzoncluster. What type of public health surveillance was described?A. Sentinel activeB. Sentinel passive C. Syndromic activeD. Syndromic passive 85. Barangay health workers are currently tasked to seek out and report individuals in their barangays whohave cough, colds, fever and chills. What type of public health surveillance was described?A. Sentinel activeB. Sentinel passive C. Syndromic activeD. Syndromic passiveAs a municipal fisheries officer (MFO) you were assigned to investigate a report in the occurrence ofpoor breeding activities of fresh water tilapia in a barangay involved in tilapia aquaculture. It wasalso reported that the fry produced are weak and are always affected by fungal and bacterialinfection. You have ordered a blood and tissue analysis of the fry and the broodstock and the resultsare:• Prostaglandin in the blood of broodstock are low as compared to normal values.• Eicosanoids levels in the larvae were below the normal levels. 1. With these results, what major dietary nutrients would you order to be analyzed ?2. Wat major nutrients would you suspect is inadequate and are causing these problems. (Bearin mind that this is a freshwater fish.)3. Discuss what are the role of this/these nutrients in Fish breeding and immune responses.Classify the ff. parasites as to: A. food-borne B- water- borne C- can be both food and water borne D- soil transmitted E- arthropod transmitted parasites Please choose the letter of the correct answer 1. Echinostoma ilocanum 2. Cryptosporidium parvum 3. Hookworm 4. Trichuris trichiura 5. Trichinella spiralis 6. Anisakis spp. 7. Giardia lamblia 8. Ascaris lumbricoides 9. Strongyloides stercoralis 10. Taenia solium
- Parasitism Mutualism O Commensalism Clear selection In Africa there exists an unusual relationship between ants and the Acacia tree. The tree sap provides food for the ants, and the ants protect the tree from predators. O Parasitism O Mutualism O Commensalism Athlete's foot is caused by a fungus that grows on the warm moist skin of the people, often around the toes of the feet. It may cause severe itching andIn response to the following question, write a sentence outline and an essay.In what ways are pandemics and endemics similar and in what ways/way arethey different?Expert Q&A Done Which of the following is/are true for Arboviral Encephalitis (Select all that apply): O Normal hosts are domesticated animals Transmitted via food OIncreases in winter (more arthropods) O Prevention involves limiting contact with arthropods (ex. mosquitoes) Use netting and insect repellants Which of the following is/are true for the treatment of Transmissible Spongiform Encephalopathies (Select all that apply): OIntravenous amphotericin B + oral 5-fluorocytosine (6-10 weeks) N Eflornithine O Miconazole has limited success, must be used very early in infection O No treatment
- Encode the word true if the statement is correct. If the underline word/s is incorrect, then correct the underlined word/s that makes the statement wrong by encoding the correct answer beside false. Answers must be encoded in capital letters 1. When Grammia incorrupta caterpillars are infected by a parasitoid, they show an increased preference for acidic toxins found in larval food plants, and by choosing to eat these toxic plants when infected, are able to increase survival.slearning i (5) | Microsoft Teams Interactive Worksheets | Wizer.m x A app.wizer.me/learn/IB6YUX udent Bookmarks WIzer.me Dashboard Enter class co A tick feeds on the dog and makes it sick. 0:08/0:17 Mutualism Commensalism Parasitism a A bird sits on a rhino and feeds on the parasites. The rhino is cleaned by the bird. Listen to instructions b Parasitism Commensalism C Mutualism Privacy. Terms Of Service OWizerme L.S (2019) Ltd. Contact usTrypanosoma in bloodstream in * human Trypomastigote Amastigote Promastigote Which of the following statements is incorrect about ectoparasite They are mainly arthropods They live on the outer surface of their hosts They live inside their hosts O Which of the following statements is * incorrect Tsetse fly transmits Trypanosoma cruzi Tsetse fly transmits Trypanosoma rhodesiense Tsetse fly transmits Trypanosoma gambiense