Polymerase inhibition. Cordycepin inhibits poly(A) synthesis at low concentrations and RNA synthesis at higher concentrations. NH2 H. он Cordycepin (3'-deoxyadenosine) a. What is the basis of inhibition by cordycepin? b. Why is poly(A) synthesis more sensitive than the synthesis of other RNAS to the presence of cordycepin? c. Does cordycepin need to be modified to exert its effect?
Q: 2) Myoclonal epilepsy and ragged red fiber disease (MERRF) is a human condition named for the ragged…
A: Mitochondrial tRNA in humans has gained interest due to the discovery of associations between point…
Q: 11) (recall) Transcription: what would be the APPROPRIATE NUCLEOTIDES (???? ?) in newly synthesized…
A: The DNA that makes the genetic material for all prokaryotes and eukaryotes is nothing but a code for…
Q: How many sites? A researcher has isolated a restriction endonuclease that cleaves at only one…
A: Restriction endonuclease is defined as an enzyme responsible for cleaving DNA into small fragments…
Q: Tick the correct statements: Remember: Tautomers are structural isomers that differ from each…
A: Ans). The first statement, the third statement, and the fourth statement are correct. Explanation:…
Q: Remember for T/F questions, either answer TRUE or FALSE, but if the answer is FALSE make sure to…
A: Unlike bacterial RNA polymerase, the eukaryotic RNA polymerase cannot initiate transcription in…
Q: Structure of lactam.. 1) Why this lactam would be evolutionarily selected against? a. Amino acids…
A: β-lactam antibiotics are antibiotics that contain a beta-lactam ring in their chemical structure.…
Q: 2) Myoclonal epilepsy and ragged red fiber disease (MERRF) is a human condition named for the ragged…
A: Myoclonic epilepsy:It is related to a family of epilepsies which are present along with myoclonus.…
Q: expression. List two types of mutations that can explain this phenotype. Justify each of the…
A: Mutation means altering the nucleotide sequence of the genome in a living organism or virus or DNA.…
Q: I Heat shock response in E. coli - What kinds of gene products are made during the response and why?…
A: The heat shock response in E. coli resulted in the production of over 20 heat shock proteins, which…
Q: What are the stop/nonsense codons?
A: Hi! Thank you for the questions. As you have posted multiple questions, I will be answering the…
Q: (a) Write a possible sequence for an mRNA segment coding for apamine.(b) Do you think apamine is…
A: Introduction: mRNA synthesizes from the copies of DNA by the process known as transcription.
Q: evasion? Because the spike protein is the target of COVID-19 vaccines. Because mutations in the…
A: A mutation is a change that occurs in our DNA sequence.Mutations arise spontaneously at low…
Q: stranded helix by doubling back. Draw the detailed chemical structures for all the base- pairing…
A: Triple helix The triple-stranded DNA is also called the H-DNA, it is called so because three…
Q: 3a) In a hypothetical cell where "wobble" pairing was not allowed (i.e. every codon must be matched…
A: Transfer RNA or tRNA is defined as a molecule which helps to decode mRNA or messenger RNA into a…
Q: Contrast DNA replication with gene expression (transcription→translation)—when does each occur?
A: DNA replication is the bio-process by which the double-helix DNA system is duplicated, whereas gene…
Q: 11) (recall) Transcription: what would be the APPROPRIATE NUCLEOTIDES (?????) in newly synthesized…
A: transcription is the process by which the dna molecules are converted into messenger rna molecule .
Q: The figure shown describes the technique of FISH. Why is it necessaryto fix the cells (and the…
A: Fluorescence in situ hybridization (FISH) is one of the defined cytogenic technique that aims to…
Q: Describe the function of each of the following Shortly. a. Amino-acyl tRNA synthetase b. E…
A: a. Amino-acyl tRNA synthetase The tRNAs are activated or charged with the aminoacid in the two step…
Q: DNA photolyases convert the energy of light in the near-ultraviolet or visible region (300–500 nm)…
A: There are a number of repair mechanisms available in order to modify the errors that occur during…
Q: how many amino acids and omega bonds? How many amino acids appear to have undergone a…
A: Amino acids are amphoteric, colorless, and crystalline solids. They are soluble in water and…
Q: Cytosine deaminationoccurs ~100 cytosinesper genome per day in a human genome. Eukaryotic cells…
A: Deamination is the removal of the aminogroup from a base. For example; the deamination of the…
Q: Biotransformation. Explain the process of enzyme induction. What are the benefits or down-falls of…
A: Enzymes are proteins that increase the rate of chemical reactions by lowering the activation energy…
Q: UDP , gemcitabine was shown to undergo two successive phosphorylations at . The product, gemcitabine…
A: GEMCITABINE is a chemotherapy medication, used to treat cancer such as breast cancer, testicular…
Q: Translation in mitochondria has many similarities to that ofbacteria explain the similarities?
A: Translation is a process in which ribosomes present in the cytoplasm or endoplasmic reticulum…
Q: ing the following DNA sequence determine the amino acid sequence: AGAGGTCCGCGTTTAGACAT5' et Val Ser…
A: Complementary strand of RNA is formed by complementary base pairing that occurs between adenine and…
Q: Protein Synthesis Article In this activity, you will write an artide explaining, in everyday…
A: Before we proceed to the details of protein synthesis let us first know what proteins are and why…
Q: SDS-PAGE with and without DDT suggests that a protein contains two peptides linked by a disulfide…
A: SDS-PAGE (Sodium dodecyl sulphate-Polyacrylamide Gel Electrophoresis) alone is not able to cleave…
Q: A lot of time and energy put into creating tRNAs; why?
A: A transfer RNA is a kind of RNA molecule that helps to match an mRNA codon with the amino acid it…
Q: 2a) In prokaryotes, a small ribosomal subunit can potentially get on an mRNA anywhere it can find…
A: The translation is the process of polymerization of amino acids to form polypeptides or protein. It…
Q: 1) Histone demethylases are important enzymes in epigenetics, and are alpha ketoglutarate-dependent…
A: Histone demethylases control the methylation state at the histone protein also stabilize the…
Q: REPLICATION TRANSCRIPTION TRANSLATION Substrate a) ribonucleotides a) phosphates b) ribonucleotides…
A: Replication is the process of DNA synthesis and to synthesize DNA we require deoxyribonucleotides…
Q: A small DNA molecule was cleaved with several different restriction nucleases, and the size of each…
A: A restriction enzyme, restriction endonuclease, or restrictase is an enzyme that cleaves DNA into…
Q: Assume that the translational error frequency, δ, is 1 x 10–4.(a) Calculate the probability of…
A: mRNAs are used to form protein by translation. The translation is performed using ribosomes, t-RNA…
Q: 1.The RNAs acting in RNAi are about 18 nucleotides long. To judge whether it is possible to uniquely…
A: Introduction RNA Interference (RNAi) Is A Biological Mechanism In Which Double-stranded RNA…
Q: 9)(recall) During translation, what TYPE OF MOLECULE carries amino acid to the site of protein…
A: The explanation is given below for the above answers.
Q: True/false? if false, justify briefly Bacterial operons gather open-reading-frames that are coupled…
A: An operon is a group of few genes that are regulated under the same promoter and operator region.…
Q: likely be able to bind a Cyclic AMP DNA binding protein? (only one strand is shown but assume DNA is…
A: CRP is a transcription factor that, when complexed with cAMP, binds DNA and activates transcription…
Q: Describe the path a cell surface receptor will take when being synthesized (starting at the…
A: Cell surface receptors are receptors that are located on the plasma membranes of cells. They…
Q: H2N 1.) Look carefully at this nucleotide: N- || НО-Р-О- N. OH a.) Number the carbons in the sugar…
A: DNA is a long, double-stranded, helical molecule composed of building blocks called…
Q: How many moles of ATP and GTP are required to synthesize a mole of a polypeptide 100 amino acids…
A: In protein biosynthesis, amino acids are activated by the binding of a specific tRNA molecule and…
Q: Calculating human genome If 1.5 percent of the human genome consists of protein-coding sequences,…
A: All humans have deoxyribonucleic acid (DNA) as constituent genetic material. This biochemical…
Q: 1. In what direction does a polymerase move when synthesizing a strand of mRNA? Briefly Explain. 2.…
A:
Q: Mutations in genes that change their pattern of expression (the time and cell type in which the gene…
A: The mutation is a change in the sequence of genome or DNA. A mutation is a major factor in…
Q: Rifamycins have been used for the treatment of many diseases, including HIV-related Tuberculosis.…
A: Rifamycin is an antibiotic used to treat various pathological conditions which is synthesized…
Q: Mutation: Thiamine Dimers A. what is a mutagen or cellular process that leads to this mutation? B.…
A: DNA damage occurs either due to mutation or error that occurs during the processing of DNA such as…
Q: a. Replicate this sense strand to create a double-stranded DNA helix. Write your answers in CAPS…
A: The sense strand is the DNA strand that has the same sequence as mRNA, which uses the antisense…
Q: Explain how these mechanisms affect protein diversity.
A: Post-translational Modification (PTM) generally refers to the large enzymatic adjustment of proteins…
Q: UESTION 16 Which of the following best describes the proper sequential order of the dogma of…
A:
Trending now
This is a popular solution!
Step by step
Solved in 4 steps
- Broken operators. Consider a hypothetical mutation in OR2OR 2 that blocks both A repressor and Cro binding. How would this mutation affect the likelihood of bacteriophage entering the lytic phase?proteins. Which of the following will tell you whether a protein would be found in the lumen of the ER? A. You run a hydropathy plot an look for hydrophobic peaks that span 20-30 amino acids B. You isolate microsomes and see whether the proteins are inserted into the membrane of the microsome C. You run a hydropathy plot an look for a lack of hydrophobic peaks that span 20-30 amino acids O D. You do in vitro translation of each protein in the presence or absence of microsomes and look to see whether there is a size change in the presence of microsomes.Leaderless. The MRNA for the A repressor begins with 5'-AUG-3', 5'-AUG-3', which encodes the methionine residue that begins the protein. What is unusual about this beginning? Would it cause the MRNA to translate efficiently or not?
- An extra piece. In one type of mutation leading to a form of thalassemia, the mutation of a single base (G to A) generates a new 3' 3' splice site (blue in the illustration below) akin to the normal one (yellow) but farther upstream. Normal 3' end of intron 5' CCTATTGGTCTATTITCCACCCITAGGCTGCTG 3' 5' CCTATTAGTCTAIIIICCACCCTTAGGCTGCTG 3' What is the amino acid sequence of the extra segment of protein synthesized in a thalassemic patient having a mutation leading to aberrant splicing? The reading frame after the splice site begins with TCT.Initiation. Bacterial protein synthesis is initiated by: a. S-adenosylmethionyl tRNA b. Methionyl TRNA c. N-formylmethionyl tRNA d. N10-formyltetrahydrofolateN"-formyltetrahydrofolate †RNA „N10True or False. Explain. A) At no time during protein synthesis does an amino acid make direct contact with the mRNA being translated. B) Because the two strands of DNA are complementary, the mRNA of a gene can be synthesized using either strand as a template.
- Yes or no only. rna seq can provide sequence and expression data do riboprobes synthesize bu in vitro transcription? does rna causes mutations and lose of function of specific genes?Please help with all parts of A, B, C, D 2. You are studying the function of a messenger RNA named Genetixrox and want to label themRNA with a radioactive atom. Assume the mRNA is long and contains all four standardRNA bases. Assume that the cell cannot convert ribonucleotides to deoxyribonucleotides (orvice versa).A. Will you generate radioactive Genetixrox mRNA with 3H-threonine? Threonine is an aminoacid. Answer yes or no, and provide a one sentence rationale.B. Will you generate radioactive Genetixrox mRNA with 3H-adenosine triphosphate? Answeryes or no, and provide a one sentence rationale.C. Will you generate radioactive Genetixrox mRNA with 3H-deoxyadenosine triphosphate?Answer yes or no, and provide a one sentence rationale.D. Will you generate radioactive Genetixrox mRNA 12C-with adenosine triphosphate? Answeryes or no, and provide a one sentence rationaleRegulation of Genes and Their products 1. Given the following genotypes, explain how the mutation (identified by a (-) superscript) wil affect E. coll grown in lactose medium. Will the lac operon be on or off? Will there be a complete set of gene products from the lac operon? What will be the implication of the missing gene product, if ever? Will the cell be able to survive in the lactose medium or not? a. I+p+o+z- y+ b. i- p+o+z+y+ c. i+p+o- z+y+ d. i+p- o+z+y+ 2. In terms of the trp operon, differentiate between two normal bacterial cultures, one grown in a medium supplied with tryptophan and the other medium without tryptophan. 3. Experiments show that mutations at gene E lead to non-repressible transcription of trp genes. Why?
- Anabolism & Catabolism of Nitrogenous Bases. a. Differentiate the processes of purine nucleotide biosynthesis & pyrimidine nucleotide biosynthesis. What are the starting materials for each process? b. Differentiate the processes of purine nucleotide degradation &pyrimidine nucleotide degradation. What are the end products of each process? c. Explain how purine & pyrimidine biosynthesis is regulated to produce balanced levels ofall four nucleotides (ATP, GTP, UTP & CTP)?Like the lac operon, the hexose operon is controlled by a separate regulatory protein under the control of its own promoter (see the schematic of the operon below). The hexose regulatory protein is sensitive to fatty acyl CoA levels. When all hexose fuel sources are depleted, the bacteria switch to lipid metabolism and fatty acyl CoA levels increase. This turns expression of the hexose operon off. +1 +1 Regulatory Gene Pregulator Poperon O Hexose Operon Genes regulator promoter operon promoterPlease help me with this question. How many amino acid residues are in the heavy and light chains of the Fab fragment, and how many amino acid residues are in lysozyme?