Q: Describe the flow of blood through the heart, naming each of the vessels bringing and taking blood…
A: Introduction The movement of gases, nutrients, and waste products throughout an organism's body is…
Q: A virgin forest in Germany has 4 species of large trees with the following proportions of each:…
A: A diversity index is a numerical indicator of the number of distinct types or species present in a…
Q: (a) Identify the dependent and independent variables in the experiment. (b) Identify the control…
A: In a research study "variables" refers to any kind of parameters that can be assessed or compared…
Q: 3. Collect the data for the absorption spectrum of chlorophyll. nm 400 410 420 430 440 450 460 470…
A: The graph plotted from the given data is as follows:
Q: What is the term used to describe the state of an axon in the later phase of an action potential…
A: Introduction A cell location's membrane potential experiences an action potential when it rapidly…
Q: The cell can use the energy released from breaking down complex molecule to build more complex…
A: Introduction : Metabolism is a term that is used to describe all chemical reactions involved in…
Q: What biochemical process must occur in the myosin head to initiate the "power stroke" in muscle…
A: Muscle system is a body system which undergo contraction and relaxation and thus impart movement to…
Q: 3' end The molecular structure of a DNA strand A W BX 0--0 CY 0-P-0 DZ Which of the four labeled…
A: The last bond to be formed will be Option A. W
Q: Insulin has what effect on potassium levels
A: Insulin is an important chemical (hormone) secreted by the pancreas that regulates the levels of…
Q: The following describes the arrangement of the phospholipid tails within the cell membrane: O a. One…
A: The cell membrane is the outer membrane of most of the organism’s cells and it separates the outer…
Q: In a gel electropherosis, Glutamate and valine created a double bond. How is that possible?
A: Proteins compose the body's fundamental structural constituents and are found in every cell and…
Q: The presence of a narrow band between the Beta and gamma regions on SPE would most likely indicate…
A: Pre-analytical steps, the major source of mistakes in laboratory diagnostics, arise during patient…
Q: Temporal summation refers to: summation of action potentials in the temporal cortex. summation of…
A: IntroductionThe process of summing, which encompasses both spatial and temporal summation, decides…
Q: Stellate cells and pyramidal cells are examples of different types of: sensory neurons. motor…
A: Information is transmitted via neurons. They communicate between various brain regions and between…
Q: A 1% to 2% shift in osmolality causes how much change in the circulating concentration of AVP?…
A: Osmolality is a measurement of a solution's concentration based on the number of dissolved…
Q: Which root system, fibrous or tap root, is more effective for storage? The epidermis of the root…
A: A taproot is when there is one main root that grows straight down deep into the soil. It only has…
Q: A laboratorian obtains a Urea N value of 61 mg/dL and a serum creatinine value of 2.5 mg/dL on a…
A: Renal function Renal function or kidney function, it remove waste material from our body in the form…
Q: Continue to assume that the same four individuals in the pedigree are albinos, and calculate the…
A: As per the guidelines, we are supposed to answer only the first three sub-parts. Kindly repost the…
Q: what prevents the dominant follicles of Waves 1 and 2 from ovulating? a. follicles are not big…
A: The formation of the follicle that houses the egg takes place during the follicular phase at the…
Q: NADH dehydrogenase 3 gene codes for a protein in the electron transport chain. Suppose that this…
A: The function of a protein depends on their structure that also depends on several factors including…
Q: Identify the basic characteristics and specialized features exclusive to each phylum of…
A: Invertebrates are the group of animal that leg vertebral column and do not have notochord .
Q: Differentiate between somatic crossing over and meiosis crossing over.
A: In the crossing over process, parts of the chromosomes can be exchanged when two chromosomes, one…
Q: What property of a material allows it to be a good conductor? Atoms in the material have weak bonds…
A: Electrical impulses The electric impulses which is produced in our body by movement of negatively or…
Q: Wilson's disease is an inherited disorder in which there is too much copper in the body's tissue. It…
A: Introduction : The study of a specific trait that is passed down from one generation to the next is…
Q: Br A
A:
Q: learn.edgenuity.com/player/ SC5181 A Mark this and return < : A lichen is an organism that is…
A: Introduction :- Obligate mutualism is a species-to-species connection in which each are totally…
Q: How much ATP is produced from one glucose molecule BEFORE Oxidative Phosphorylation? a. two b. four…
A: Introduction: In the presence of oxygen, glucose molecules are broken down into energy during…
Q: Since the cell membrane is not identical in all regions it is referred to as the following: O a.…
A: Cell membrane also known as plasma membrane is a semi-permeable/selectively permeable membrane…
Q: What is the advantage of immunological staining over traditional staining? In what field of science…
A: Immunological Staining: It is referred to as an advanced level of staining method wherein an…
Q: The following describes the arrangement of the phospholipid heads within the cell membrane: Oa. One…
A: Singer and Nicolson in 1972, described the phospholipid bi-layered structure of a cell i.e., the…
Q: Would the respiration rate be different for a person who had just exercised instead of sitting in…
A: Respiration : it is one of the essential physiological process in human body. It Is defined as the…
Q: Question 10 How does a plant take in nitrogen? O A OB Oc D A plant takes in nitrogen as nitrites…
A: Introduction Nitrogen is an important macronutrient for plants and is a crucial part of amino…
Q: When an electric force is applied to a lipid, the electron clouds stretch and d but the electrons do…
A: Electric fields can induce lateral reorganization of lipids in fluid bilayer membranes. Biological…
Q: Calculating the Value of Chi-Square Once you've defined the null hypothesis (and know what you're…
A: Introduction A chi-squared test, also known as a square test, is a type of statistical hypothesis…
Q: urinalysis identifies a negative result for reducing sugars, yet the test for glucose (glucose…
A: Reducing sugar A sugar that act as reducing agent is known as reducing sugar.
Q: The following is the location of the cell membrane proteins: O a. Some only face the extracellular…
A: Cell membrane The living semi permeable membrane that is selectively permeable and allow both…
Q: .Beta thalassemia is caused by a mutation in beta hemoglobin. Beta hemoglobin is a member of a group…
A: Beta thalassemia is a inherited blood disorder. *Persons with beta thalassemia makes less hemoglobin…
Q: What does the term forensic science mean? 2. Describe in detail one example of a forensic…
A: Forensic science is the use of scientific methods or expertise to investigate crimes or examine…
Q: Pertaining to the middle of the body medial Pertaining to the side of the body lateral Lying on the…
A: The given quetion is combination of various quetion releted human Anatomy and Physiology. Human body…
Q: Below is the colony diameter for each yeast culture grown on PDA and AcA incubated at 35°C measured…
A: Yeast The fungi which is microscopic unicellular eukaryotic organism.
Q: Question 10 A diagram shows cellular activity across a cell membrane. Glucose in high concentrations…
A: The plasma membrane of the cell is a selective barrier that controls the movement of different…
Q: The ECG records the electrical stimulation of cardiac muscle by the conduction system and not the…
A: We know that Electrocardiogram (ECG) is used to measure the changes in the electrocardiograph. One…
Q: Order: Pentam (pentamidine isethionate) 3 mg/kg IM q.i.d. The label reads: Add 3 mL of sterile water…
A: Pentamidine is used to treat a serious lung infection (Pneumocystis pneumonia-PCP) in people with…
Q: 13. Unraveling the structure renders the enzymes useless, this unraveling leads to loss of its…
A: According to our guideline we can answer only first three subparts of a question. So, please upload…
Q: need to prepare a standard calibration curve for gamma globulin. absorbances on Y and mg of standard…
A: To obtain the values, first average the data for individual points and then subtract the blank's…
Q: 26. Liver cell makes some enzymes with the endomembrane system and transports the manufactured…
A: Endomembrane system is formed by some cell organelles to perform a special function like vesicle…
Q: The following is the function of the cell membrane proteins: O a. Channels O b. Receptors O c.…
A: Introduction All cells have a cell membrane, also known as a plasma membrane, which separates the…
Q: 14 15 16 17 18 19 Which of the following examples could help reduce competition between two species?…
A: Competitive exclusion can easily be avoided if one or both of the species that are competing-…
Q: If you got the previous question correct, lets try a question slightly harder but one along the…
A: Introduction Codons are units of genomic information made up of three nucleotides (trinucleotides)…
Q: Synapomorphic characteristic of monophyletic group of chondrichthyes and bony fishes
A: A synapomorphic character is shared by some taxa but not others because the former inherited it from…
Trending now
This is a popular solution!
Step by step
Solved in 4 steps
- how many letters of rna molecules in squence does it take to provide the code for a single amino acid"a messenger rna is 423 long how many amino acids it can code"At least three types of RNA are required for protein synthesis. Compare and contrast mRNA, FRNA, and tRNA by moving the descriptions of their structure and function to the appropriate categories. Some phrases may describe all three types of RNA. MRNA FRNA tRNA MRNA, FRNA, and tRNA Answer Bank contains nucleotide triplets that code for specific amino acids acts as an enzyme for peptide synthesis has a convoluted structure with a three-base sequence called an anticodon moves amino acids to the site of protein synthesis in eukaryotes, can exist outside the nucleus moves genetic information out of the nucleus and into the cytoplasm composed of ribonucleic acid
- A segment of a polypeptide chain is Arg-Gly-Ser-Phe-Val-Asp-Arg. It is encoded by the following segment of DNA: GGCTAGCTGCTTCCTTGGGGA CCGATCGACGAAGGAACCCCT Note out the mRNA sequence generated by the template strant to produce that polypeptide chain Label each stran with its correct polarity (5' and 3' ends on each strand)(ol soupe bannos96 SAM 3 A small strand of DNA has this sequence: 0pxbeter owl nade hoparg TACCGGAAACTG ATGGCCTTTGAC a. If the TOP strand is the template strand, what will be the mRNA made from this DNA read from left to right? What process allows for the mRNA to be made? b. If this is a eukaryotic mRNA, where does transcription occur? What would happen if the mRNA was not processed? c. What is the sequence of the protein made (use the genetic code below)? What process allows for the protein to be made?Complete the complementary strand: mRNA transcription ATTCGAGGCTAA
- Which of the following statement(s) about "wobble" base is/are correct? Please make sure to select ALL correct answer options. at the 5' end of the TRNA anticodon. Owhere the amino acid is coupled to tRNA. where tRNAS display structural instability. where inosine nucleotide can sometimes be found.RNAi is produced when Question 26 options: a single-stranded DNA shares the same sequence as the target mRNA . a single-stranded RNA shares the same sequence as the target mRNA a double-stranded DNA shares the same sequence as the target mRNA a double-stranded RNA shares the same sequence as the target mRNAAnticodons are located on __ Select an answer and submit. For keyboard navigation, use the up/down arrow keys to select an answer. a MRNA b TRNA FRNA d none of the above
- Small nuclear RNA from 50-200 bases that combine with proteins to form complexes capable of editing mRNA. True or falseTable 1. The Genetic Code: Codons and Their Amino Acids First Two Nucleotides of Codons Last Nucleotide of Codons The Amino Acids A UU phe phe leu leu Abbreviations Names UC gly glycine ser ser ser ser UA tyr tyr term ala alanine term val valine UG cys cys term trp ile isoleucine leu leucine CU leu leu leu leu ser serine CC pro pro pro pro threonine proline aspartate glutamate lysine arginine thr CA his his gin gin pro asp glu lys CG arg arg arg arg AU le ile ile met AC thr thr thr thr arg asparagine glutamine cysteine methlonine asn AA lys lys asn asn gin AG ser ser arg arg cys met GU val val val val trp phe tryptophan phenylalanine tyrosine histidine GC ala ala ala ala tyr his GA asp asp glu glu GG gly gly gly gly term termination 3. Use Table 1 to read the codons below. Find the name of the amino acid and write it in the space provided. If the letters code for more than one amino acid, separate the names by dashes. b. UUA: c. GAG: d. UAUCUA: e. AUCUUG: f. AAGAGUUCG: g. AAAUUUGGG: h.…The original DNA sequence TACACCTTGGCGACT I need the mRNA sequence and the amino acid sequence And also the mutation type