Q: Which of the following is the inner most layer of human eye? a) Retina b) Choroid c) Sclera d)…
A: Introduction - Our visual organ is the eye. Because of its intricate construction, an image can flow…
Q: Please could you explain how lymphocytes (especially B) can maintain receptors on their surfaces? Is…
A: Lymphocytes are a type of white blood cell that plays an important role in the immune system. They…
Q: Which of the following statements is true when considering this figure? It represents natural…
A: ANSWER) (f) all of the above are true. The bottle full of marble and and the jar represents the…
Q: Question 16 In base-excision repair, the first enzyme in the sequence is, _ creating a(n) _ site. (A…
A: INTRODUCTION Base excision repair This is a cellular mechanism that repairs damaged DNA.
Q: What is Pepsin
A: Digestion of food begins inside the mouth with the help of the enzyme salivary amylase and digestion…
Q: A potato cube is placed in a solution. The volume of the potato increases. which statement below is…
A: Osmosis is a process of flow of solvent molecules from lower concentration to higher concentration…
Q: Match the column I with column II and select the correct option. Column- Column- II a. Ovule (i)…
A: Ovary is an organ in the female reproductive system of both plants and animals. It is the organ in…
Q: The eukaryotic transcription factor that exhibits a sequence specificity for the TATA box is: A)…
A: Transcription is the first step in the gene expression which transfers the genetic information…
Q: 10. Modified true or false: Write T if the statement is true; if false, write F, underline the word…
A: Plants are classified as flowering plants and non-flowering plants. Flowering plants are divided…
Q: The acquisition of memories can be demonstrated in rodents on a T-maze task. In this task, a food…
A: The task described the homeostasis and growth factor of mice . The innate and adaptive behaviour…
Q: Question 47 The proofreading of DNA is essential for faithful replication. A) True B) False
A: Proof reading of DNA is essential for maintaining a homogenous DNA across multiple cycles of…
Q: The eukaryotic metallothionein gene promoter consists of all EXCEPT:
A: A promoter is a region of DNA where RNA polymerase begins to transcribe a gene.
Q: We are not usually consciously aware of our blood glucose levels because: O Information about blood…
A: * Nervous system divided into two main parts that is central nervous system (CNS) peripheral…
Q: Referring to Figure 17-26, draw the product if breaks occurred within genes A and B
A: An inversion is a chromosomal rearrangement where a portion of a chromosome is flipped end-to-end.…
Q: Define disinfection. Compare/contrast it with sterilization, antisepsis and bacteriostasis.
A: Sterilization, disinfectant, antisepsis and bacteriostatic all terms are related to halt the growth…
Q: Q.6.What Is Typhoid? List out the symptoms of Тyphoid?
A: Typhoid fever is an infectious disease caused by the bacteria Salmonella typhi, also known as S.…
Q: Acetylcholine is necessary for the depolarization of skeletal muscle cells. Which of the following…
A: * Acetylcholine is an chemical that functions in brain and body as neurotransmitter. *It is an…
Q: Which of the following is required for RNA splicing to occur? A a free 5 hydroxyl created by…
A: In vertebrates, there are three signals for direct splicing: - 5/ splice site hydroxylation…
Q: Match the force for evolution with its description, definition or example. This force typically…
A: Introduction Evolution is the process of a species' features changing over numerous generations…
Q: (True/False) Scientists have now been able to use the genomic data to determine whether a particular…
A: "Genes" are the fundamental unit of heredity. They store genetic information in the form of DNA,…
Q: In goats, the gene for coat color is on an autosome and light brown color is dominant to black. A…
A: Let the gene determining the same be B/b So light brown male is BB Dark brown female is bb BBX bb Bb…
Q: Are plants male female or both? EXPLAIN Please answer asap and your content should not be palgarised
A: The term "plant" refers to a diverse group of living organisms that all belong to the Plantae…
Q: what ate the 3 levels of biological organization of E.coli? Please answer asap and type your answer…
A: First let's discuss what is levels of biological organization, Living things are organized into…
Q: I understand how nuclear factor-kB (NFKB) works in the inflammatory response but what is the…
A: NFKB is a transcription regulator that is activated by cytokines, oxidant-free radicals, ultraviolet…
Q: Evolutionary Sciences ask: O "Why" questions O "What" questions "How" questions O "When" questions
A: The main function of evolutionary scientists is how the today's organisms evolved into the current…
Q: What is a recombinant DNA vaccine? List two such vaccines. State their advantages.
A: Plasmids, which are small circular pieces of DNA, are used in the production of recombinant DNA…
Q: Select the correct answer. Marcus is admitted to the hospital for a bone marrow stem cell transplant…
A: The cell division is the production of new daughter cells from the old mother cells. Usually in…
Q: Task 2 Week 15 4. FIGURE 4 shows sugar transport in phloem. Phloem A В 888 Source cell $8888 Sink…
A: Introduction The movement of materials across cell membranes is referred to as cell transport.…
Q: Which of the following DNA pol I activities would be MOST important in the removal of the primer? A…
A: The DNA polymerase I has two actions: - Synthesis of Okazaki fragments to complete gaps. 5/ to 3/…
Q: A.Binomial Theorem : Marco, heterozygous for able to his roll (Tt), marries Mary v heterozygous for…
A: Homozygous or heterozygous dominant traits are expressed where as recessive traits are always…
Q: Question 3 What are the diseases associated with hypocomplementaemia and which complement deficiency…
A: * Hypo complementaemia can be referred as decreased complement levels and secondary complement…
Q: The lack of a cure or effective treatment for malaria can be attributed to. The expected return on…
A: Answer :-(D) The lack of cure or effective treatment for malaria can be attributed to malaria is no…
Q: Do phylogenetically proximal species have cells with proximal chromosome counts?
A: Introduction - The idea of phylogenetic species (PSC) The idea of a species as an irreducible group…
Q: Why is the base pairing in D N A important? How does mRNA production in eukaryotes differ from the…
A: Deoxyribonucleic acid (DNA) is a polymer made up of two polynucleotide sequences which curl around…
Q: State with examples why a few pathogens are organ/tissue-specific.
A: * When microbes affect the entire organ like lungs or kidneys or liver etc .. it is called as organ…
Q: Q4.3. After the rising phase, which ion channel is responsible for action potential returning to its…
A: Introduction An action potential is a rapid rise or an explosion of electrical activity and…
Q: What are the checkpoints in the completion of the life cycle of nematomorphs? Would it be easier if…
A: The phylum Nematomorpha (also called horsehair worms) is constituted of orders: Nectonematoidea…
Q: Briefly discuss Mendelian Inheritance with that of crossing-over.
A: The Mendelian genetics gives us idea about the inheritance of genetic materials from the parents to…
Q: A Lynx and jaguarundi share a more recent common ancestor than do ocelot and caracal. The speciation…
A: * A cladogram tells and shows the ancestral relationships among organisms and cladograms were drawn…
Q: what is the relationship between genes and traits expressed in individuals? a) gene code for DNA,…
A: Every living organisms contain DNA as the genetic material. In case of eukaryotic cells the DNA is…
Q: What is a recombinant DNA vaccine? List two such vaccines. State their advantages.
A: Vaccines can be defined as biological preparations that help in building active adaptive immunity…
Q: Question 23 Which of the following is an underlying requirement for universal health coverage? High…
A: Which of the following is an underlying requirement for universal health coverage? A. High quality…
Q: What is the difference between the concepts of karyotype and genome?
A: Karyotype refers to an individual's shape, size, banding patterns, and number of chromosomes. The…
Q: By average, how many Sau3A (5’GATC3’) sites are there in a 10 kd DNA molecule? (1/4)^6 * 10,000 =…
A: Answer :- For the first question, the restriction site for the enzyme Sau3a is composed of four…
Q: Column A Column B Column C I. a. Spherical/globular A. Epithelial I. b. Striated, multinucleated,…
A:
Q: Cite 4 important Glycobiology applications or studies
A: Glycobiology is the branch of Biology that deals with the study of the structure, function,…
Q: John, a 47-year-old white male, weighs 86 kg and is 1.7 m tall. Calculate his body fat percentage…
A: Body Mass Index BMI is an indication of fatness in the body. It measures the body fat depending on…
Q: using, 3’ TGAGGCGCTAGGCCAAGCGGTAAGGATGCATGGTCGTGGTAG , What would be the resultant type of error…
A: The given sequence is 3'TGAGGCGCTAGGCCAAGCGGTAAGGATGCATGGTCGTGGTAG5' The mRNA sequence will be…
Q: Members of Suliformes typically lay 2-3 eggs, but it is rare that more than one nestling survives.…
A: *NOTE: Kindly repost for other questions Dear Student as per the guidelines we are supposed to…
Q: Part 1: Monohybrid Cross 1. Set up and complete Punnett squares for each of the following crosses.…
A: NOTE: since you have posted multiple questions with multiple subparts, so we will be solving the…
Trending now
This is a popular solution!
Step by step
Solved in 3 steps with 3 images
- Measure the uptake of leucine by epithetial cells of the mouse intestine. Measurements of the rate of update of L-leucine, D-Leucine, and L-valine , with and without Na+ in the assay were perform and yield different results (see table below). A) What can you conclude about the properties and mechanism of leucine transporter? B) Would you expect L-leucine uptake to be inhibited by Ouabain, which is a cardiac glycoside drug treatment?I have this strain of e coli. Is P+ o+ Z+ Y+ / I- P+ oC Z- Y+ Will beta-galactosidase and permease be expressed? If they are will they be inducible or constitutive?Direct mutagenesis of Ca2+ ATPase gene resulted in the replacement of two amino acid residues - Asn111 and Asn114 to Ala. These substitutions led to the reduction in Ca2+ transport activity by 10% and 50%, respectively. On the other hand, directed mutagenesis that resulted in the alteration of four Glu residues in the lumenal loop of this transport protein to Ala, did not affect the Ca2+ transport. Provide the possible explanation for the observed differences in the Ca2+ transport activity between the protein with Asn->Ala substitution and the protein with Glu->Ala substitution.
- Consider this strain of E. coli with lac operon alleles: IS pt o* z* y+ /T p* oCz- Y+ In a written response, briefly explain if beta-galactosidase AND permease will be expressed, and if so, will they be inducible or constitutive.. CTP synthetase catalyzes the glutamine-dependent conversion of UTP to CTP. The enzyme is allosterically inhibited by the product, CTP. Mammalian cells defective in this allosteric inhibition are found to have a complex phenotype: They require thymidine in the growth medium, they have unbalanced nucleotide pools, and they have a mutator phenotype. Explain the basis for these observations.Consider the following simple regulatory pathways. Assume the full pathway is shown. A- E- B- F- C- G- D- 1 A H- 2 B || L You identify several null mutations (a complete deletion of the gene). For each mutant (indicated with a - sign), determine whether the final product (I, J, K or L) is inducible, uninducible, or constitutive. 3 C 4 D inducible inducible constitutive uninducible constitutive inducible inducible E uninducible F G H > I > J K
- Interpret this: what does this say about b-galactosidase production? Does Lac mutant exhibit it?Consider the following simple regulatory pathways. Assume the full pathway is shown. A- E- B- F- C- G- D- 1 A H- 2 B || L You identify several null mutations (a complete deletion of the gene). For each mutant (indicated with a - sign), determine whether the final product (I, J, K or L) is inducible, uninducible, or constitutive. 3 C 4 D- [Choose ] [Choose ] [Choose ] [Choose ] [Choose ] [Choose ] [Choose ] E [Choose ] F G I H || J K. Mutants of Neurospora crassa that lack carbamoyl phosphate syn- thetase I (CPS I) require arginine in the medium in order to grow, whereas mutants that lack carbamoyl-phosphate synthetase II (CPS II) require a pyrimidine, such as uracil. A priori, one would expect the active CPS II in the arginine mutants to provide sufficient carbamoyl phosphate for arginine synthesis, and the active CPS I in the pyrimidine mutants to "feed" the pyrimidine pathway. Explain these observations.
- Consider the gal10D56 reporter gene. In 300 words or fewer, describe 1) the role of GAL7 in galactose metabolism and its importance for cell function 2) the mutation present in the gal10D56 reporter gene 3) the consequence of this mutation for GAL7 expression in wild type cells, 4) the mechanism by which certain mutations can suppress the effects of gal10D56, and 5) the specific purpose for using this reporter gene.The PYK gene codes for the expression of pyruvate kinase, which is one of the enzymestargeted for anti-cancer drug design. You have identified an RNAi that targets the mRNAof PYK gene. To study the effect of the RNAi towards pyruvate kinase, the respected RNAiis expressed in Saccharomyces cerevisiae. The level of pyruvate kinase can be detectedwith a fluorescent antibody.(a). Predict the result that you will obtain in recombinant S. cerevisiae that expresses therespected RNAi.(b). Compare the result in Q3a(i) with the wild-type S. cerevisiae.Gal 4 is involved in the regulation of galactose metabolism. Describe how transcription would be affected in the presence of a mutation that resulted in an inability of Gal80 to enter the nucleus?