Some pre-diabetics wish to eat like diabetics so that they do not get diabetes. I was one of these. I am 5'10" and used to weigh 195 pounds.  Please come up with a diet plan for one day for that person consisting of one breakfast, lunch, dinner, and two (2) snacks.

Q: Which two functional groups are present in this molecule? (see the three representations below) H…

A: The molecule shown in the figure is the amino acid glycine where the alpha carbon is bound to…

Q: . Show (on the image) 3 steps that must be taken to produce a mature mRNA molecule from this pre-…

A: The genetic material which is the DNA undergoes the process of replication to produce exact copies…

Q: draw a punnett square for both parents are dominate tall, name the 4 possible offspring.

A: Punnett square is a square diagram which is used to find the genotypes of a cross. It is used to…

Q: How are teratogens related to critical periods? Teratogens have varying impacts during different…

A: Tertogen is a chemical substance on whose exposure birth defects are caused in the foetus. These…

Q: Does the action potential in a single axon increase in amplitude when the stimulus amplitude is…

A: Introduction An action potential is the electrical signal that travels along an axon in response to…

Q: need help understanding how to calculate CFU/mL

A: CFU stands for Colony Forming Unit that is useful for determining the bacterial count in particular…

Q: Explain a way that sensory nervous system transduce stimuli with different strengths using concept…

A: The nervous system is a complex network of nerves and cells that send signals throughout the body.…

Q: Critical Thinking Questions: 1. Identify the changes in sensitivity that occur in the hypothalamus,…

A: 1.   The decrease of sensitivity in hypothalamus and pituitary to negative feedback means that it…

Q: Define plaque-forming unit and explain its role in the quantification of viruses

A: INTRODUCTION Plaque-forming is a phenomenon seen in immunology research where antibodies are tested…

Q: Design and describe an experiment using celery stalks to demonstrate how certain conditions will…

A: A hypothesis is an assumption formed based on evidence. This is the first step in any investigation…

Q: The enzyme amylase will affect the breakdown of carbohydrates, but it will not affect the break-…

A: The body system is the network of organs and tissues that interact and depend on one another to…

Q: Draw the three different cell junctions, and explain how the structure of one of these junctions…

A: In tissues, cells are connected to one another via cell-cell junctions, which also control tissue…

Q: A blastocyst is about 2 weeks old. Implantation is important at this stage because the cells need an…

A: Early human embryos go through the blastocyst stage, which is characterised by a spherical structure…

Q: d. You have a 10 gram/ml. stock solution of protein. To make 50mL of 25 mg/ml solution, add, of…

A: We are given a 10gm/ml stock solution of protein. We have to makea 50 ml solution with 25mg/ml…

Q: A child weighs 11 kilograms. The health care provider orders a drug as follows: 0.2 mg/kg…

A: Drugs can be administered orally, intravenously, intramuscularly, subcutaneously route, rectal,…

Q: Using the provided materials and the microscope itself, review the parts of the microscope including…

A: Introduction: A microscope is a scientific instrument that magnifies objects, allowing for closer…

Q: Compare artificial selection and natural selection

A: Selection In biology, selection refers to the survival and reproduction tool of individuals having…

Q: mitosis meiosis prophase prometaphase metaphase anaphase telophase ||| eukaryotic cell division used…

A: Cell division are of two types : mitosis and meiosis. A cell copies all of its components, including…

Q: Which structure with a diameter of 20 nm is found attached to membranes in a cell? a) Golgi body b)…

A: The plasma membrane, also known as the cell membrane, is the membrane found in all cells that…

Q: Calculate Simpson's Diversity Index D. Show your solutions. species Number (n) Gammarus pulex (water…

A: We are given number of individulas of different species. We have to calculate simpson's diversity…

Q: 4. Complete the table below to show the differences between active transport. Requires energy input…

A: Introduction: The cell membrane, also known as the plasma membrane or cytoplasmic membrane, is a…

Q: Discuss the possibility of life on Mars. Will extremophiles prove useful?  Can you explain the…

A: Astrobiology is interested in the possibility of life on Mars because of how close it is to Earth…

Q: Chromosomal pairing and separation during meiosis I occurs between: Selected answer will be…

A: Meiosis is a form of cell divison which occurs mainly in the reproductive cells.In this mode of cell…

Q: he stru

A: Introduction: Anatomy is the branch of biology concerned with the study of the structure of…

Q: How are cells and genes related? Cells produce the material genes carry. Genes are made up of cells.…

A: Cells are defined as the basic structural and functional unit of any living organism. A cell has a…

Q: The major bonds in cellulose are α(1→4) bonds. During mRNA splicing, U2 binds to the 3’ splice site.…

A: 1.The major bonds in cellulose are α(1→4) bonds. (False)  Cellulose is the most important structural…

Q: population of 600 scorpions was split into four populations when irrigation canals were built…

A: Introduction: The location or type of environment in which an organism lives and develops is…

Q: What is the genetic mechanism behind BWS and RSS in Parental imprinting?

A: A subset of genes are expressed differently depending on the parent, a phenomenon known as genomic…

Q: Choose which one Hypotonic, Hypertonic, Isotonic

A: Introduction: The cell membrane, also known as the plasma membrane, is a thin, semi-permeable…

Q: A mother wants to find ways to remind her infant of her while she is not there. Which artifact would…

A: A newborn or infants senses are developed but not as precisely as in others.

Q: In what ways do steroid hormones differ from peptide hormones? More than one aswer may be correct.…

A: 12.Hormones are chemical messengers of low molecular weight which are released in very trace amounts…

Q: What biomolecule composes RNA pol II and TFs?

A: Introduction: The process of gene expression uses genetic information stored in the DNA sequence to…

Q: ’ GGACCTATCAAAATCCTTAATGCGCTAGGATAGCTAACGCATCCAC3’ Fill in the complimentary DNA strand and…

A: Watson and Crick elucidated in 1953 , the famous double stranded structure of the DNA molecule and…

Q: Based on the observed inheritance pattern and ratio of phenotypes, what are the genotypes of the…

A: Mutations in the CFTR gene lead to the genetic condition known as cystic fibrosis (CF). The CFTR…

Q: cr

A: Introduction: A dichotomous key is a tool used to identify species by asking a series of questions…

Q: It says that one of these are wrong on mine. Do you know which one it could be?

A: Introduction :- Eukaryotes are a group of organisms that possess cells with a defined nucleus and…

Q: Part 1 and Pa

A: Introduction: Genetic variation refers to differences in DNA sequence, gene expression, or phenotype…

Q: Explain possible explanations for the differences noted among the diffusion rates of the three…

A: Among the few factors that affect the diffusion rate, molecular weight is the major one. As is…

Q: Which of the following is NOT one of the negative effects of food processing in the manufacturing of…

A: Food processing is the conversion of raw materials into food products using a variety of techniques,…

Q: In the binomial naming system, scientific names are written in italics, with the first word…

A: Organisms are classified so that they can be grouped and their characteristics could be studied…

Q: You have a pea plant with a yellow pea phenotype but do not know if the genotype is homozygous (YY)…

A: The yellow and green alleles, respectively, are designated by the alleles ‘Y’ and ‘y’. ‘Y’ is…

Q: Our phenotypic traits and personalities come from the expression of our genes. When and how do you…

A: Phenotypic traits are the observable physical and behavioral characteristics of an organism, which…

Q: Iron atoms have been detected in the sun's atmosphere, some with many of their electrons stripped…

A: Atoms are made up of fundamental particles called electrons and protons. Protons have a positive…

Q: Could you please explain these:   1. Why analyze the unknowns in a (short) serial dilution rather…

A: Introduction: DNA concentration refers to the amount of DNA present in a sample. It is typically…

Q: SCIENTIFIC METHOD  Make Your own Scientific Method Example Activity Sheet  I.) Problem: Hypothesis:…

A: Introduction  A hypothesis is a proposed explanation for a phenomenon or a prediction about the…

Q: i don't see how the result turn out for this cross? red x kitey 18 red 9 kitey 6 black

A: Introduction  Genotypes are the genetic makeup of an organism, represented as the combination of…

Q: draw a punnett square, one parents is domincat tall, one is mixed hybrid, name 4 possible offspring.

A: Introduction: The scientific study of heredity and variation in living things is known as genetics.…

Q: CELL MEMBRANE VOCABULARY TERMS LIST Use the terms below to fill in the blanks. Cell membrane Lipid…

A: Cell membrane which is also known as plasma membrane.It forms the external boundary of the cell and…

Q: Mytilus Mercenaria Neotrigonia Velesunio Hyridella Castalia Triplodon Etheria Chambardia…

A: Introduction Evolution is the process by which species of organisms change over time through natural…

Q: What result in adaptation comes from natural selection?

A: Evolution is a naturally occurring continuous process in nature that involves changing species…