The following DNA sequence corresponds to the two extreme ends of a gene's coding region:105' ATG-GAA-CCGEach codon is separated by a dash and the middle of the gene is represented by "...".Refer to the codon table to answer each question.First position (5' end)U13C#tAUUUUUUCUUAUUGCUUCUCCUACUGPheLeuLeuAUUAUC lleAUACAG-TGA 3'*$UCUUCCUCAUCGCCUCCCCCACCGully understand the concept covered in this question?ACUACCACA15Second positionCAU(49SerUProThr16UAUUACUAA stopUAGstop4-CAUCACCAACAGAAUAACAAAIt's MuddyTyr17HisGlnAsnGluQ SearchSIt's ClearJ+&UGUUUGCCUGA stop AUGG TrpGCGUCGCCGACGGAGUAGCAGAGLC18NCysArgSer*fgUCAGhpUCAaDIIThird position (3' end)✓ Submit AnswerCf10(O□ The following DNA sequence corresponds to the two extreme ends of a gene's coding region:105' ATG-GAA-CCGEach codon is separated by a dash and the middle of the gene is represented by "...".Refer to the codon table to answer each question.First position (5' end)U13C#tAUUUUUUCUUAUUGCUUCUCCUACUGPheLeuLeuAUUAUC lleAUACAG-TGA 3'*$UCUUCCUCAUCGCCUCCCCCACCGully understand the concept covered in this question?ACUACCACA15Second positionCAU(49SerUProThr16UAUUACUAA stopUAGstop4-CAUCACCAACAGAAUAACAAAIt's MuddyTyr17HisGlnAsnGluQ SearchSIt's ClearJ+&UGUUUGCCUGA stop AUGG TrpGCGUCGCCGACGGAGUAGCAGAGLC18NCysArgSer*fgUCAGhpUCAaDIIThird position (3' end)✓ Submit AnswerCf10(O□

Introduction = The genetic code consists of tripletsThe group of three nucleotides that together…

The following DNA sequence corresponds to the two extreme ends of a gene's coding region: 5' ATG-GAA-CCG ... CAG-TGA 3' Each codon is separated by a dash and the middle of the gene is represented by "...". Refer to the codon table to answer each question. First position (5' end) U UUU UUC UUA UUG CUU CUC CUA CUG Phe Leu Leu Second position C A UCU UCC UCA UCG CCU CCC CCA CCG AUU ACU AUC lle ACC AUA ACA Ser Pro Thr ully understand the concept covered in this question? UAU UAC UAA stop UAG stop CAU CAC CAA CAG AAU AAC AAA Tyr His Gin Asn UGU UGC UGA stop UGG Trp CGU CGC CGA CGG AGU AGC AGA G It's Clear Cys Arg Ser Am U A G U G C Third position (3' end)

The following DNA sequence corresponds to the two extreme ends of a gene's coding region: 5' ATG-GAA-CCG ... CAG-TGA 3' Each codon is separated by a dash and the middle of the gene is represented by "...". Refer to the codon table to answer each question. First position (5' end) U UUU UUC UUA UUG CUU CUC CUA CUG Phe Leu Leu Second position C A UCU UCC UCA UCG CCU CCC CCA CCG AUU ACU AUC lle ACC AUA ACA Ser Pro Thr ully understand the concept covered in this question? UAU UAC UAA stop UAG stop CAU CAC CAA CAG AAU AAC AAA Tyr His Gin Asn UGU UGC UGA stop UGG Trp CGU CGC CGA CGG AGU AGC AGA G It's Clear Cys Arg Ser Am U A G U G C Third position (3' end)

Biology Today and Tomorrow without Physiology (MindTap Course List)

5th Edition

ISBN:9781305117396

Author:Cecie Starr, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Christine Evers, Lisa Starr

Chapter7: Gene Expression And Control

Section: Chapter Questions

Problem 1VQ

See similar textbooks

Similar questions

Indicate the amino acid sequence of the protein encoded by the following mRNA molecule. Use the genetic code table and assume that the very first “AUG” the ribosome encounters will serve as the start codon and specify methionine. 5’-AAUUCAUGCCCAAAUUUGGGGCACGAAGCUUCUUAGGCUAGUCCUAAAAAA-3’
Use the codon chart to translate the following MRNA transcript into a protein. Please format your answer in this way .....*. Seond letter UUU UUC UCU UCC UCA UAU UAC U Cys Phe UGU UGC UAA Stop UGA Stop A UAG Stop UGG TrpG Tyr C Ser UUA Leu UUG UCG CUU CCU CGU CGC CAU His CUC CAC C. CỦA CUG Leu Pro Arg CCA CGA CAA CAG Gin CGG AAU AGU AGC AUU ACU Asn Ser AUC lle ACC AAC Thr AUA AUG Met ACG ACA AAA AGA A. Arg AAG Lys AGG GCU GCC GCA GUU GAU GGU GGC Asp GUC Val GUA GAC GAA GAG Ala Gly GGA GGG Glu GUG GCG AUGCCUGGACAUUUUCAAGUAUAA HTML Editor BIUA - A - I E Z I 1 I x x, E E Paragraph First letter Third letter
An mRNA transcript is listed below and contains both start and termination codons. Assume that the initial methionine will stay on the polypeptide in this case. What amino acid sequence will be specified during translation? List the amino acids. The start codon is highlighted. 5’ – CAGCCAAGCAUGCUCGCAAAUGGACGUUGAUAUUUUGUC – 3’
If DNA segments changes from GCATAG to GCATA, this is a: MRNA Codon/Amino Acid Chart First Base Second Base Third Base U A G 0001 Phenylalanine UCU UAU1 Tyrosine (Tyr) UAC UGUT FCcysteine (Cys) UGCJ U UUCJ (Phe) UCC Serine (Ser) UCA U UUA1 UAAT UGA - Stop A FLeucine (Leu) UUG- FStop UAG- UCG- UGG - Tryptophan (Trp) G CU- CCU CGUT CAU1 Histidine (His) CAC U CUC FLeucine (Leu) CUA CC Proline (Pro) CCA CGC FArginine (Arg) CGA CAA1 Glutamine A CAGI (Glu) CGG- CUG- CCG- G AUU AAU1 Asparagine ACU1 AGUT FSerine (Ser) AGC- AUC FIsoleucine (le) ACC Threonir AACJ (Asn) A AUA- ACA (Thr) AAA1 FLysine (Lys) AAG- AGA, FArginine (Arg) AGG- A Start Methionine (Met) ACG- AUG - GUU- GCU GAU- GGU | Aspartic Acid GAÇJ(Asp) U GỤC Valine (Val) GUA GCC FAlanine (Ala) GGC Glycine (Gly) GGA G GAA1 Glutamic Acid A GCA GCG- GAGJ (Glu) GGG- GUG- G
The DNA sequence below is transcribed from left to right (the partner/coding strand is shown). Using this sequence, write the sequence of the polypeptide that results from this gene. Be sure to appropriately label the ends of the molecule. 5'-ATGCACGGCGACTAG-3' Second letter A UAU Tyr UAC First letter U A G U UUU1 UUC UUA LOU Leu CUU CUC CUA CUG Phe GUU GUC GUA GUG Leu AUU AUC lle AUA AUG Met Val C UCU UCC UCA UCG CCU CCC CCA CCG ACU ACC ACA ACG GCU GCC GCA GCG Ser Pro Thr Ala CAU His CAC CAA CAG Gin AAU Asn AAC AAA 1 Lys AAG LYS G {}a UAA Stop UGA Stop A UAG Stop UGG Trp GAU 1 GAC Asp GAA GIU Glu GAGJ UGU UGC CGU CGC CGA CGG AGU AGC AGA AGG Cys GGU GGC GGA GGG Arg Ser Arg DOA DOA DOA DUTO Third letter Gly
For the messenger RNA sequence below, find the beginning of the amino acid coding sequence and translate the sequence using the genetic code provided below. 5' - AAUUAUGGGCAAUAUGCCGGGCcGGUUAAGCG - 3' Second Letter A UGU cys u UGC Phe UCU UU U UUC UUA UAU Tyr Ser UAC UAA UAG Leu UCA Stop UGA Stop UUG UCG Stop UGG Trp CUU CU CAU His CGU c cuc Leu ccc ССА CCG Pro CÁC CAA CAG CGC CGA CGG Arg CUA CUG Gin 1st 3rd letter Ser u letter AUU ACU AAU AAC AAA AAG Asn A AUC AUA AUG lle ACC ACA AGU AGC AGA AGG Thr Lys Arg Met ACG GUU G GUC GUA GUG GCU GAU GAC GAA Asp GGU Val GCC Ala GGC Gly GCA GGA Glu GCG GAG GGG G
If DNA segments changes from GCATAG to GCATGG, this is a: MRNA Codon/Amino Acid Chart First Base Second Base Third Base A G UUU1 Phenylalanine UCUT UAUT FTyrosine (Tyr) UAC UGU, U FCysteine (Cys) UGCJ UUCJ (Phe) UCC Serine (Ser) UCA U UGA - Stop A UUA1 FLeucine (Leu) UUG- UAA1 FStop UAGJ UCG- UGG - Tryptophan (Trp) G CUU CAU1 CCU1 CGUT Histidine (His) CAC- CUC CCC Proline (Pro) CCA CGC FLeucine (Leu) CUA FArginine (Arg) CGA CAA1 Glutamine A CAGJ (Glu) CGG- CUG- CCG- ACU AAUJ Asparagine AUUT AGUT FSerine (Ser) AGC- U AUC FIsoleucine (lle) ACC AACJ(Asn) Threonine A AUA- (Thr) AAA1 FLysine (Lys) AAG- АСА AGA, FArginine (Arg) AGG- A Start Methionine AUG- (Met) ACG- G GUU GCU, GAU1 Aspartic Acid GGU U GAÇJ(Asp) GUC Fvaline (Val) GUA GCC GGC G Alanine (Ala) GCA Glycine (Gly) A GAAJ Glutamic Acid GGA GAG- (Glu) GUG- GCG- GGG- G
The DNA in the coding strand below contains a short imaginary sequence for a short protein in Squibillus notables (imaginary bacterial organism). Indicate the mRNA and amino acid sequences. Label the 5' and 3' ends, the amino (N-terminus) and carboxyl (C-terminus) ends and start/stop codons, if present, as appropriate. 5'- ATGTACCTCGACGATCAAGGCAA -3'
Using the genetic code table provided below, identify the open reading frame in this mRNA sequence, and write out the encoded 9 amino acid long peptide sequence: 5'- CGACAUGCCUAAAAUCAUGCCAUGGAGGGGGUAACCUUUU C A G U UUU Phe UCU Ser UUC Phe UCC Ser UAC UCA Ser UAA UCG Ser UAG UUA Leu Leu G C CUU Leu CUC Leu CCC CUA Leu CUG Leu AUU lle AUC lle AUA lle AUG Met ACG ACU Thr ACC Thr ACA Thr Thr A UAU Tyr UGU Cys Tyr UGC Cys CCU Pro CAU His CGU Arg Pro CAC His Pro CAA Gln CGC Arg CGA Arg CCA CCG Pro CAG Gln CGG Arg GUU Val GCU Ala GAU GUC Val GCC Ala GAC GUA Val GCA Ala GAA GUG Val GCG Ala GAG Stop UGA Stop UGG AAU Asn AAC AAA AAG AGU Asn AGC G Lys Lys Asp Asp Glu Glu Stop A Trp Ser Ser AGA Arg AGG Arg GGU Gly GGC Gly UCAG GGA Gly GGG Gly с U C A G U C A G U C A G
Refer to the information on the genetic code. Use this information to determine how many amino acids are coded for by the mRNA sequence AUGCGCAGUCGGUAG. The genetic code Second letter of codon UAU UAC JUU Phenylalanine uCU UUC Phe) UUA Leucine (Leu) UUG Tyrosine (Tyr) GCysteine (Cys) UGC 1oStop codon |UGG Tryptophan (Trp) CGU CGC UcC Serine (Ser) UCA ucc CCU cC Proline (Pro) Stop codon UAG Stop codon CAU Histidine His) CU CUC CUA CUG Arginine (Arg) Leucine (Leu) cca CAA CCA CGA Glutamine (Gin) CAG AUU AUC AUA ACU Isoleucine (le) AAU AAC AGU AGC Asparagine (Asn) Serine (Ser) ACC Threonine (Thr) ACA Methicnine ACC start codon GCU Lysine (Lys) AGA Arginine (Arg) ARC AGS GAU Aspartic acid (Asp)G0 GAC GUU GUC Valine (Val) GCC Alanine (Ab) GG Glycine (Gly GUA GUG GCA GCG GA Glutamic acid (Glu) GA GGG GAG 4 15 First letter of codon Third letter of codon
A strand of DNA contains this nucleotide sequence: TACTGCCTCCCCATAAGAATT. The corresponding nucleotide sequence of the mRNA strand from this DNA template is as follows: AUGACGGAGGGGUAUUCUUAA. Q: What is the amino acid sequence of the polypeptide that is produced form the mRNA strand? As well, draw a labelled diagram of the mRNA molecule being transcribed from this strand of DNA.
If the sequence of amino acids encoded by a strand of DNA is serine-alanine-lysine-leucine, what is the order of bases in the sense strand of DNA? Use the codon chart below to help you: second letter A G UAU Tyr UGU UUU UCU Phe Сys UUC UCC UAC UGC Ser UAA stop |UGA stop | A UAG stop UGG Trp UUA UCA UUG Leu G UCG CUU CCU CAU CGU His CUC ССС САС CGC Leu Pro Arg CUA ССА САА CGA Gln CUG CCG CAG CGG AUU ACU AAU AGU Asn Ser AUC le A AUA AAC AAA AGC AGA Arg АСС Thr ACA AUG Met | ACG AAG Lys AGG GUU GCU GAU GGU Asp GUC Val GUA GAC S GAA Glu GCC GGC Gly GGA Ala GCA GUG J GCG GAG GGG) O 3' AGACGTTTCAAT 5' O 3' UGUGCAAAGUUA 5' О 5 TGTGCTTТCТТА 3' first letter UCAG UCAG PCAG third letter