Q: The amount of light entering the eye is determined by the size of the: O The pupil O The lens O The…
A: Pupil present in the center of iris .The amount of light entering the eye control by the size of…
Q: What prevents the immune system from responding to and destroying tumour cells in d) malignant…
A: Answer :: The answer should be written in a stuctured manner with different headings like…
Q: List three types of noncoding RNA and describe their functions.
A: An RNA molecule that is not translated into a protein is called a non-coding RNA (ncRNA). The DNA…
Q: 6. If you have the HIV virus, can you present with symptoms?
A: HIV (human immunodeficiency virus) damages CD4 cells, also known as T cells, in the immune system.…
Q: . Describe which enzymes are required for lactose and tryptophan metabolism in bacteria when lactose…
A: ANS 1.The enzymes of the lactose operon are needed to break down and use lactose as an energy…
Q: gametes are formed by in a diploid organism. O diploid / meiosis haploid /mitosis haploid/fission s…
A: Cell division involves production of two or more than two daughters cells from a mother cell. Cell…
Q: The vibrations of the reach the scala vestibuli first:
A: This question is based on sense organ (ear).
Q: Neisseria lactamica Pseudomonas aeruginosa Pseudomonas fluorescens Pseudomonas putida Alcaligenes…
A: Gram-negative and positive Gram-negative and positive bacteria can be differentiated by using gram…
Q: Biology Question
A: Introduction Taxonomy is the branch of science that deals with the classification of organisms in…
Q: It seems paradoxical that a lipid bilayer can be fluid yet asymmetrical. Explain.
A: Introduction :- The lipid bilayer (also known as the phospholipid bilayer) is a thin polar membrane…
Q: Which part of the bone makes red blood cells? Cancellous/Spongy Bone O Trabeculae O The Marrow…
A: Red blood cells are the most common type of blood cells present in blood and it is the principal…
Q: Don't copy from internet. Thanks!! 1. When does the food chain starts? How come it never exceeds…
A: Food chain refers to the sequence of events in an ecosystem where one living organisms eats other…
Q: 15.Muscle contraction is caused by (This is a multiple choice question choose the answer from the…
A: Sarcomere is the functional unit of contraction. The distance between two Z lines is called…
Q: Cocaine is a drug that acts by blocking dopamine transporters, the proteins responsible for the…
A: Cocaine is a drug that is highly addictive, it increases alertness, attention, and energy. It is an…
Q: Different hypersensitive responses can result from a bee sting. What type of hypersensitivity could…
A: i) This case is of hypersensitivity type 1 as the effect disappears within an hour and does not get…
Q: Give the protein synthesized of the given mRNA sequence. No need to explain. Just give the answer.…
A: Introduction Translation is the process by which ribosomes in the cytoplasm or endoplasmic reticulum…
Q: 7. Bromophenol Blue, a reagent or standard that is usually used to determine the void volume of a…
A: NOTE: since you have posted multiple questions, So we will be solving the first three parts for you.…
Q: Draw and describe the different types of egg as to the concentration of yolk they contain. Give…
A: Almost all the female animals lay eggs of various species, such as birds, reptiles, amphibians, a…
Q: Describe the process leading to mast cell activation / degranulation by IgE in type I hypersensitive…
A: Introduction Type I hypersensitivity (also known as acute hypersensitivity) is an allergic reaction…
Q: The amount of glycogen stored in muscles is enough for hours' exercise? A. True B. False
A: Our cells' primary fuel source is glucose. When the body does not need glucose to function, it…
Q: The two primary types of toxins associated with foodborne illness affect the ? A. Nervous system…
A: Introduction :- The gastrointestinal tract is the digestive tract or passageway that connects the…
Q: Which of the following would likely not be a result of character displacement? A: The competition…
A: INTRODUCTION: Character displacement is an evolutionary behavior that developed to make less…
Q: Fadi touched a pen lightly and he did not feel how soft it was, while when he firmly touched the…
A: Tactile sensation refers to the sense of touch. It is one of the five senses in our body. Tactile…
Q: Please answer both questions asap. Thank you. - Why would SV40 cause the culturing to occur of HMLE…
A: 1. SV40 three genes encoding SV40 large T antigen , telomerase catalytic subunit and H Ras…
Q: The field of genetics that studies the mode of inheritance of complex or quantitative traits is…
A: Mode of inheritance of traits is studied under genetics.
Q: Which of the following factors in today’s world make it dif-ficult to keep disease-causing…
A: Diseases can be infectious diseases, hereditary diseases, deficiency diseases, and physiological…
Q: autonomic nervous system
A: Nervous System: The system which involves the network of nerve cell which help in the transmission…
Q: The term "Superbug" refers to? A. Certain bacteria strain that can grow in all kinds of unfavorable…
A: Introduction :- Superbugs are bacteria, viruses, parasites, and fungi strains that are resistant to…
Q: identify each pedigree a and b as autosomal recessive or autosomal dominant. Write all the genotypes…
A: A pedigree chart displays a family tree, and shows the members of the family who are affected by a…
Q: The United States, Canada, and the European Union allow the use of recombinant bovine growth hormone…
A: Recombinant bovine growth hormone (rBGH) is an artificial hormone, created by man which is aimed at…
Q: In toddlers, a higher fiber diet can? A. Enhance the absorption of iron and zinc B. Result in…
A: Fiber alongside with liquid intake moves rapidly and generally effectively through your…
Q: Which of the following is NOT true about the Charophycean green algae? a. They generally have…
A: Anatomy, which reveals that evolutionary ties may be proven through homologous structures, and…
Q: 2. Give examples on how work and energy are essential in biological systems.
A: Work is defined as a task that involves the mental and physical efforts to get it done. Energy is…
Q: Some traits that can be counted and expressed in whole numbers, such as bristle number in…
A: Introduction Traits are features or attributes of an organism that are influenced by the environment…
Q: Why are there so many differentchromatin remodeling complexes incells? What are their essential…
A: Chromatin remodeling is one of the most important concepts. It uses the energy from the hydrolysis…
Q: When a depolarization wave reaches the synaptic end bulb of a presynaptic neuron, the NEXT event is…
A: Hormones are proteins that are created in one place in the body and then moved to another to exert…
Q: The code for a fully functional protein is actually coming from an mRNA transcript that has…
A: Conversation of non functional mRNA to functional mRNA is done in many steps.. 1. A…
Q: What is the significance of fertilization and how does it restore diploidy?
A: Fertilization is the process of fusion of haploid male gamete or sperm with a haploid female gamete…
Q: Find the flaws! Biological systems ore organized into organisms, followed by communities,…
A: The Flaws are as follow -
Q: Chapter 22 7) Match the signal word with the appiloximate amount of toxin needed to kill an average…
A: Nearly all pesticide products registered and labelled for sale in the United States must include…
Q: Create a paragraph to explain the concept of ecological succession. Provide real examples (cite your…
A: Please follow step 2 for detailed explanation.
Q: You have two populations of snakes in different enclosures in a zoo. In enclosure A the frequency…
A: Answer :- Option (A) is correct. - 0.7
Q: Which of the following is an example of ecological competition? A. A cheetah chases and kills a…
A: an ecological niche is an area used or inhabited by species that have adapted especially for it. For…
Q: Ir Semitend Sem eanoeus
A: Answer pig bones labelling
Q: AUGGUGCCACCGCUGAAGAAGCCUGGACCCUGGCACCCUGUGGACCCUGCAUCCUGGACCCUGGGUGCCACCGCUGAAGAAGCCUGGACCUAGGGUGCCA…
A: The process of protein synthesis involves two major steps - Transcription Translation During…
Q: Which statements are true? Explain why or why not.1 Each member of the human hemoglobin genefamily,…
A: The statements are well analysed and the answers are given below.
Q: A salmon feeds on crabs and small fishes, which in turn feed on zooplankton that feed on…
A: Overfishing is a process of catching too many fish at once, so the breeding population becomes too…
Q: Second letter UUU UCU UCC UAU UAC UGU Tyr Phe UUCJ UUA UUG. UCA UCC Ser UAA Stop UGA Stop A UAG Stop…
A: 1)Codon on mRNA strand which codes for Methionine is AUG from 5' to 3' direction. This is an…
Q: What is meant by the overload principle? A. Stretching a muscle group beyond the joint's range of…
A: To develop any area of physical fitness, the overload principle states that the person must…
Q: New genetic variation may occur because of ( select 3 correct answers)
A: Answer :- New genetic variation may occur because of :- - new mutations. - genetic drift. - gene…
The U.S has no labeling requirements for products containing genetically modified organisms (GMOs)?
A. True
B. False
Trending now
This is a popular solution!
Step by step
Solved in 3 steps
- I want the results to be described in words.Order in which the ingredients used in the dog labels must be presented. Put your referencesWhich of the following activities would contravene the Policy on Manufacturing and Compounding Products in Canada? a. Reconstitution of a sterile powder injection b. Preparation of a sterile admixture using commercially available sterile components c. Preparation of a sterile dosage form not commercially available d. Preparation of a commercial sterile product to reduce drug cost
- Give an example for any biopharmaceutical produced by Recombinant DNA Technology (except insulin). Answer option a,c,d a. What is the name of the drug/trademark?b. Write its mode of action.c. List the experimental steps under the laboratory conditionsd. List the production steps in the factoryHighlight the difference between the following Labels: 1. Dispensing Label 2. Manufacturer Label You should use you own imagination to make the labels keeping the Legal Requirements in place.The color of the positive result for Iodine Test.* A. Pinkish B. Orange-Brown C. Blue-Black D. Reddish
- The options are shown in picture 2..Mr. Steve is 25 years old, caucasian, and physically fit. He wanted to travel alone before pursuing his career since he just graduated from college. His first destination is the Banaue Rice Terraces. He arrived in Ifugao with much hospitality from the locals. He was invited to attend a traditional Cordilleran wedding. Since he like foreign and exotic dishes, he tried the local soup dish pinikpikan with etag. Later on he was offered a "local" delicacy to pair with the rice wine tapuy. He was enjoying the taste of the "local" delicacy and was asking for the recipe but the locals just laughed and told him that it is a secret. The next day, he went on his hiking to the rice terraces and was amazed by the view. The local guide asked him if he would like to visit Tappiya Falls before going back to his accommodation which he gladly agreed on. Since it is his first time going to the place, he already drank all of his water. The local guide pointed a clear shallow portion of a stream to fill…Below are the ingredients of a heirloom recipe of Ana's family. Identify the organisms for each of the heirloom recipe ingredients? Ingredient - Organism 1.Beef- 2. Carrots- 3. Sweet potato- 4. Garlic- 5. Onion- 6. Peppers- 7. Tomato paste- 8. Liver spread - 9. peppers- 10. Cheese- 11. Milk- 12. Soy sauce- 13. Oil- 14. Salt-