This activity uses the metaphor of decoding a secret message for the Protein Synthesis. PARTIALLY SOLVED MESSAGE GIVEN: DNA code message --> GAA TAG AAA CTT ACT TAG AGC ATT CCT GCC CTT CGA TGC ATC SOLUTION (steps 1-4) 1. MRNA (built to match the DNA message, letter for letter-- !! CUU AUC UUU GAA UGA AUC UCG ... ... ... 2. TRNA (determined by matching letters (bases) with those in mRNA)-------→ GAA UAG AAA CUU ACU UAG ... ... ... ... ... ... ... ... 3. Amino acids carried by each tRNA (according to -> I h L G I e dictionary, below)----- u e u 4. Symbols of amino acids:--→ L F E

This activity uses the metaphor of decoding a secret message for the Protein Synthesis. PARTIALLY SOLVED MESSAGE GIVEN: DNA code message --> GAA TAG AAA CTT ACT TAG AGC ATT CCT GCC CTT CGA TGC ATC SOLUTION (steps 1-4) 1. MRNA (built to match the DNA message, letter for letter-- !! CUU AUC UUU GAA UGA AUC UCG ... ... ... 2. TRNA (determined by matching letters (bases) with those in mRNA)-------→ GAA UAG AAA CUU ACU UAG ... ... ... ... ... ... ... ... 3. Amino acids carried by each tRNA (according to -> I h L G I e dictionary, below)----- u e u 4. Symbols of amino acids:--→ L F E

Name: Worksheet (Nucleic Acid)Name:Section:Date:This activity uses the meta
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Worksheet (Nucleic Acid)Name:Section:Date:This activity uses the metaphor of decoding a secret message for the Protein Synthesis.PARTIALLY SOLVED MESSAGEGIVEN: DNA code message --> GAA TAG AAA CTT ACT TAG AGC ATT CCT GCC CTT CGA TGC ATCSOLUTION (ste

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 17QP: Given the following mRNA, write the double-stranded DNA segment that served as the template....

See similar textbooks

Similar questions

Name (Last, First): DNA An RNA polymerase attaches to the DNA and transcribes the DNA to mRNA Ribosone BIO 340 Activity # 1: DNA and the Central Dogma Complete: DNA Coding 5' ATG TGG ATT CTC AAG ATC AAT AGT 3' DNA template 3 5' Cytoplasm Nuckus Nuclear pore ARNA Use the mRNA codon sequence and the genelic Landelable in order to find the amino acid (AA) sequence of the protein. Example: if mRNA sequence is GUU then the corresponding amino acid 3-letter is Valine (Val) and the corresponding amino acid 1-letter is V. mRNA codon 5' FIRST (5') LETTER tRNA codon 3 U AA 3-letter AA 1-letter Amino acid AA - Amino acid A tRNA THE GENETIC CODE New protein being built U Pie (F) ասա UUC) ԼԱՔ Uva) Lou (L) Leu (L) val (M) Use numbers 1 to 3 to indicate the correct order of the flow of biological information. Translation Replication Transcription Hydroxyl group Deoxyribose sugar DNA's charge is negative due to following (circle the correct one): An alpha helix and a beta sheet in a protein are a type…
Original sequence: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a translational start): 5’-GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3’ Question: 4) In a mutant you discovered that the underlined nucleotide has been deleted. What would the resulting peptide sequence be? What type of mutation is this? 5’-GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3
DNA, RNA, AND PROTEIN SYNTHESIS (FILL IN THE BLANKS) GIVEN THE FOLLOWING CODING SEQUENCE FOR DNA, PROVIDE THE SEQUENCE OF THE COMPLEMENTARY(TEMPLATE) SEQUENCE. CODING SEQUENCE/ 5' ATGCATAGATTAGGATATCCCAGATAG 3' COMPLEMENTARY SEQUENCE: 3' ______________________________ 5' CODING SEQUENCE ~ mRNA transcript: 5' _______________________ 3' TRANSLATE THE GIVEN mRNA TRANSCRIPT INTO A POLYPEPTIDE SEQUENCE (REFER TO THE GENETIC CODE) POLYPEPTIDE SEQUENCE: _________________________________
SAY IT WITH DNA: PROTEIN SYNTHESIS WORKSHEET: Practice Pays Student Handout Having studied the process by which DNA directs the synthesis of proteins, you should be ready to decode some DNA "secret" messages. To do this, you must follow the procedure of protein synthesis as this is taking place right now in your cells; no short cuts! Practice these steps by following and finishing the partially solved message below. STEP 1: "Build" the mRNA molecule, matching the RNA nucleotides to the DNA nucleotides properly, letter by letter. (For purposes of simplicity, it will be assumed that this mRNA is bacterial; there are no introns to cut out!) STEP 2: Figure out the tRNA triplets (codons) that would fit the mRNA triplets (letter by letter). STEP 3: Look up each tRNA codon in the tRNA Dictionary (below), and find the corresponding symbol and amino acid abbreviation for that codon. Record that one-letter symbol (and its amino acid) below each codon. "Spc" = "space". If you have done this…
INSTRUCTION: = IF BOTH STATEMENT ARE TRUE = IF FIRST STATEMENT IS TRUE WHILE SECOND STATEMENT IS FALSE = IF FIRST STATEMENT IS FALSE WHILE SECOND STATEMENT IS TRUE = IF BOTH STATEMENTS ARE FALSE STAMENT 1: Amino acyl tRNA synthase is the enzyme responsible for joining amino acid together STAMENT 2: Nucleus is the part of the cell where translation takes place ANSWER: STAMENT 1: DNA sequences where RNA polymerase binds initially is called promoter sequences STAMENT 2: UV light causes adenine to dimerize ANSWER: STAMENT 1: Guanosine is the name of the compound formed when guanine is bonded to ribose STAMENT 2: DNA pairing is the term that refers to the process when two complementary and single stranded DNA combine ANSWER:
RNA Transcription, Translation, and Mutation Worksheet First, here is a strand of DNA. This strand contains both a gene and its promoter region. Circle the promoter region in blue, draw a yellow box around the TATA box, draw a green box around the start codon, and draw a red box around the stop codon: TATATATATTACGTTGCATACGCTCAACGGTCGAAACTGCATGGGCAC ATATATATAATGCAACGTATGCGAGTTGCCAGCTTTGACGTACCCG Now imagine this gene has been transcribed into RNA. What would that RNA strand look like? Before the above RNA strand can be translated, a few modifications must first take place (in eukaryotes). What are they? 1) 2) 3) Using a codon chart of your choice (one can be found here, or here) translate the above RNA transcript (assume no splicing took place). Write the three letter abbreviations for the amino acids in the image below: Now imagine that a mutation took place in the original strand of DNA (marked in red) TATATATATTACGTTGCATACCCTCAACGGTCGAAACTGCATG…
Codon chart: We interpret mRNA 3 base pairs at a time. This is known as a codon. A codon table can be used to translate a genetic code into an amino acid sequence. The full set of relationships between codons and amino acids (or stop signals) is called the genetic code. The genetic code is often summarized in a table like the one below. Second letter A G UUU UUC J UGU Cys UCU) UCC UCA UCGJ UAU U Phe Tyr UACS UGCJ Ser UAA Stop UGA Stop A UAG Stop UGG Trp UUA UUG FLeu G CUU ) CỤC CUA CUG CCU ) ССС ССА CCG CGU CGC Arg CAU) CÁC His САА Leu Pro CGA Gin CAG CGG AUU AAU ACU АСC ACA Asn AGU Ser AAC JAsh AGC. AUC le A AUA AGA Arg Thr AAA AAG. }Lys A AUG Met ACG AGG J G GUU GUC G Val GUA GUG GCU) GCC GCA GCG GAU1 GACS GAA) GAG Glu GGU GGC Gly U C A Ala GGA GGG] G First letter UUAG Third letter
Translation of mRNA Using the codon chart provided, translate the following messenger RNA sequence into an amino acid sequence (protein). AUG AAA GGU CAC CCC TAG
Molecular Biology (Biol-L211) Dr. Nole Central Dogma Practice - Processes The general flow of genetic information is diagrammed below. Think carefully about what type of molecule is represented by each item in the diagram and clearly address each of the following. A. Label each structure as mature mRNA, pre-mRNA, protein, or DNA. B. Label each arrow to indicate which is processing, transcription, replication, and translation. C. Identify the general location (on the appropriate molecule) of the promoter sequence and the terminator sequence. D. Identify the specific location of the place where the start codon and stop codon function most directly (i.e., which molecule is actually translated?). E. Where does RNA polymerase bind to begin transcription? F. Where specifically does the ribosome bind to begin translation-i.e., what are the ribosome binding sites (in both prokaryotes and eukaryotes) and where are they found? G. Label each end of the mature mRNA and the polypeptide to correctly…
Hi, Could you please comfirm the following question. I have selected option c) because tRNA is the the complimentary pairs of mRNA so I figured the oppside end of the tRNA would be the same as the mRNA. When I have tired to double check my answer, no tutor has selected this answer. Thank you in advance, Like mRNA, tRNA has a ribose sugar, U instead of T, and is single stranded. Unlike mRNA, which remains a long single strand of nucleotides, tRNA folds so that some areas pair up. The resulting structure has an anticodon on one end and a site for an amino acid to attach on the other end. There is base complementarity (A pairs with U and G pairs with C) between an mRNA codon and tRNA anticodon.If the amino acid lysine attaches to a tRNA, which of the following anticodons could be at the opposite end of the tRNA molecule? a. UUU and UUC b. AGA and AGU c. AAA and AAG d. UCU and UCA
Insert Table Chart Text Shape Media Comment Which of the following statements regarding "start" and "stop" signals apply to both transcription and translation? the start and stop signals are "read" (i.e., interpreted) the start and stop signals reside within nucleic acid the start and stop signals are part of the genetic code the start and stop signals reside in RNA. start and stop signals are needed because the products must have a definite length and sequence.
Molecular Biology (Biol-L211) Dr. Nole Central Dogma Practice - Processes The general flow of genetic information is diagrammed below. Think carefully about what type of molecule is represented by each item in the diagram and clearly address each of the following. A. Label each structure as mature mRNA, pre-mRNA, protein, or DNA. B. Label each arrow to indicate which is processing, transcription, replication, and translation. C. Identify the general location (on the appropriate molecule) of the promoter sequence and the terminator sequence. D. Identify the specific location of the place where the start codon and stop codon function most directly. E. Where does RNA polymerase bind to begin transcription? F. Where specifically does the ribosome bind to begin translation-i.e., what are the ribosome binding sites and where are they found? G. Label each end of the mature mRNA and the polypeptide to correctly specify polarity. (You should use the labels 3', 5', C-terminus, and N-terminus.)