Q: Which of the following is NOT a component of the cell plasma membrane? A. cholesterol B. proteins C.…
A: The plasma membrane, also known as the cell membrane, is the membrane that divides the cell's inside…
Q: Compare and contrast the receptors and signalling cascade, and the physiological roles for two…
A: * Neurotransmitters are the chemical messengers of the body which are used by the nervous system to…
Q: Given what is known about humans, why is it unlikely that a thermophile or a psychrophile would be a…
A: .m Humans are warm-blooded. Their body temperatures do not change when the temperature outside…
Q: What would be the phenotypes for each of the following genotypes for Huntington’s Disease? a. Hh =…
A: Neurodegenerative diseases are a diverse group of disorders. They have a progressive degeneration…
Q: Describe three drivers of mutualism breakdown. For these drivers of mutualism breakdown, in what…
A: Mutualism refers to a partnership in which both creatures get something from the other. In this…
Q: What is the second greatest known cause of amphibian declines, after habitat loss? What is the…
A: Amphibians are those animals which can live on both land and water. Their decline would impact…
Q: Are there carriers for Huntington's Disease? Please explain. b. What is the impact of HD on…
A: * Huntington's Disease is a rare and inherited disorder which causes degradation of nerve cells in…
Q: A) Most ligers (offspring of a male lion and a tigress) and tigons (offspring of a male tiger and a…
A: Reproductive isolation mechanism The mechanisms are a set of evolutionary mechanisms, behavioral,…
Q: does alcohol increase the risk of breast cancer?
A: The vast majority of breast cancers are carcinomas. Adenocarcinomas are the most prevalent breast…
Q: If a mass extinction is happening, why don’tI notice species disappearing around me?
A: An extinction event is a significant and rapid loss of biodiversity on the planet. A dramatic change…
Q: A science student is watching a television debate on the genetic cloning of animals. In order for…
A: According to the question, A Science student is watching a television debate on the genetic cloning…
Q: what data will be neede to collect if you are interested in comparing how species occurrence and…
A: The term Beta diversity was first coined by R.H Whittaker. It depicts the ratio of species between…
Q: Due to degradation of DNA during food processing what is the best PCR target size for detecting…
A: Food processing conditions such as high temperature, pH variations, enzymatic activities,…
Q: Question 3. Eukaryote cells are living cells that are specialized to deal with changes in the…
A: The immune system checks the body for infections or problem-causing chemicals and fights any harmful…
Q: Compare and contrast the receptors and signalling cascade, and the physiological roles for two…
A: There are few important points that should kept in mind : As we know that all cells receive and…
Q: Question 31 FLAG QUESTION Which of the following is NOT true? Answers A- D Alcohol dehydrogenases…
A: Introduction :- Alcohol dehydrogenases are a class of dehydrogenase enzymes found in a variety of…
Q: If FOV is 5 mm and the number of cells in FOV is estimated at 35, what is the cell size in mm? In…
A: Field of View = Field Number (FN) ÷ Objective Magnification.
Q: The function of the enzyme acyl CoA synthetase is O ATP-dependent activation of fatty acids using…
A: During fatty acid oxidation the free fatty acids that enter the cytosol from the blood cannot pass…
Q: Function of lysosomes
A: Lysosomes are tiny bodies with a single membrane covering them. It contains a variety of hydrolytic…
Q: How might the bacterial growth curve change if a facultative anaerobe was first monitored for growth…
A: *Facultative anaerobes are bacteria which can grow in presence or absence of oxygen. * oxygen…
Q: For an unknown dihybrid species, the trisomy state has 2n+1=33 chromosomes. How many chromosomes are…
A: In the trisomy state the unknown hybrid species has, 2n + 1 = 33 2n = 33 - 1 2n =…
Q: Mrs. Marshall was admitted to your surgical progressive care unit after repair of AAA. Her husband…
A: Introduction An abdominal aortic aneurysm, or AAA, is treated by endovascular repair. A protrusion…
Q: What is sere?
A: Ecological succession: The mechanism whereby the mix of species and environment in a given area…
Q: 5. Explain how diagnosis of hookworm infestation can be established.
A: Hookworm infestation Hookworm infection is due to the parasitic roundworm. This roundworm is found…
Q: why the negative control sample (from an unaffected individual) only produced one band. b.…
A: Huntington's Disease It is a rarer disorder where the brain cells or the neurons starts degenerating…
Q: Which microbe requires serum components to be added to the growth medium?
A: Some microbes are nutritionally fastidious and hence needs some substances to be added to the growth…
Q: Describe how a mutation in the regions below could cause such a drastic effect that it creates a…
A: The transcription is the production of RNA from the DNA and the translation is the production of…
Q: E7 A Moving to the next question prevents changes to this answer. Question 1 What are the two phyla…
A: Helminths are invertebrates, large macroparasites general term meaning worm. Some of helminths are…
Q: Q A fHen one turn of he citrưc acid ccle, thich conlron C) Oxaloocebate? Draw the caid crcle…
A: a. After one citric acid cycle, those carbon atom is liberated which come from acetyl-CoA.
Q: True
A:
Q: What is the definition of volatilization? Justify two practices that might help to reduce…
A: An ecosystem is essential to all life. Ecosystems rely on all of their elements to function…
Q: Briefly discuss any two characteristics of microorganisms that should be considered when assessing…
A: Microbiology is the study of microorganisms and associated ideas. Microbiology has gone a long way…
Q: Artificial selection works more rapidly than natural selection. T. True F False
A: Natural selection is the process through which population of living organisms adapt and change.…
Q: does ileum plays an important role in the absorption of B12 and provides the acidity and pepsin to…
A: Yes, Vitamin B12 substitutes are absorbed mostly through the ileum.The intrinsic factor is a…
Q: Explain what will happen to the products of replication if DNA polymerase I is absent.
A: DNA polymerase Group of enzymes that catalyse the synthesis of DNA during replication. Prokaryotic…
Q: What is the importance of reviewing one’s decision?
A: Decision making is the capability to take an accurate and timely response to an action. It indicates…
Q: One of the following is NOT a serous membrane. Which one? A. pleura B. peritoneum C. mucosa D.…
A: Introduction:- Body membranes are thin tissue sheets that surround the body, line body cavities, and…
Q: 6.Rank order the following 10-base dsDNA sequences by "melting" temperature to single strandedness,…
A: In DNA there are four nucleotides, or bases, in DNA: adenine (A), cytosine (C), guanine (G), and…
Q: 9. What is parthenogenesis? 10. Humans can be classified as deuterostomes. Explain what that means.
A: Fertilization is a sexual reproduction process in plants that happens after pollination and…
Q: Criteria Type of Skeleton Hydrostatic Exoskeleton Support composition fluid (mostly water) hardness…
A: A skeleton is the structural framework that holds an animal's body together. There are three…
Q: AND Based on the knowledge you gained from the cloning module, which of the bands in the figure is…
A: Agarose gel electrophoresis is used to monitor the progress of a restriction enzyme digestion, to…
Q: Briefly summarize the study and the defects of cell junctions or the extracellular matrix that leads…
A: There are three components to the Extracellular Matrix. Insoluble collagen - structural framework…
Q: Your exercise assessment determined the Max VO 2 to be 10-METs which is an oxygen consumption of…
A: Oxygen consumption has a tendency to get increased proportionally with that of the increasing work…
Q: a. Femur b. Ulna c. Radius d. Talus e. Fibula f. Tibia Patella h. Vertebra i. Scapula j. Humerus k.…
A:
Q: principle behind agarose gel electrophoresis with reference to the pore sizes. Indicate the…
A: AGE or the Agarose Gel electrophoresis AGE is a molecular technique used for the separation of…
Q: Briefly compare (a) restriction enzymes, (b) engineered nucleases and (c) CRISPR-Cas in terms of…
A: Enzymes can be known as proteins that enable bodies' metabolism, or chemical processes, go more…
Q: Urine Color Changes with Commonly Used Drugs I. Matching Type: Match column A with Column B. Write…
A: The color of normal urine ranges from pale yellow to deep amber. This is because of a pigment…
Q: Identify which statements describe open or closed circulatory systems. Closed Орen Answer Bank fluid…
A: Introduction:- The Circulatory System Is Open: Invertebrates are the primary hosts of this system.…
Q: Twenty snakes with the Aa genotype migrated to a population of 80 snakes of the same species with…
A: Hardy-Weinberg Equilibrium is a concept that serves as a benchmark for researchers to analyze gene…
Q: This is a picture of the initial experiments to figure out how auxin and phototropism worked. How do…
A: Auxin is a plant hormone which functions in stem elongation .It shows apical dominance and inhibits…
If a strand of mRNA contains the sequence, UAG CUA UCA AAU AGA, what tRNA anticodons would be needed to translate the sequence?
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- A certain mRNA strand has the following nucleotide sequence: 5AUGACGUAUAACUUU3 What is the anticodon for each codon? What is the amino acid sequence of the polypeptide? (Use Figure 13-5 to help answer this question.) Figure 13-5 The genetic code The genetic code specifies all possible combinations of the three bases that compose codons in mRNA. Of the 64 possible codons, 61 specify amino acids (see Figure 3-17 for an explanation of abbreviations). The codon AUG specifies the amino acid methionine and also signals the ribosome to initiate translation (start). Three codonsUAA, UGA, and UAGdo not specify amino acids; they terminate polypeptide synthesis (stop).If the genetic code uses triplets, how many different amino acids can be coded by a repeating RNA polymer composed of UA and UC (UAUCUAUCUAUC ...)? a. one b. two c. three d. four e. fiveIf the genetic code used 4 bases at a time, how many amino acids could be encoded?
- A mRNA has the following sequence and direction: 5’-AUGUCAACCUAA-3’ What would be the anticodon sequences formed from this mRNA during the translation process?Indicate the amino acid sequence of the protein encoded by the following mRNA molecule. Use the genetic code table and assume that the very first “AUG” the ribosome encounters will serve as the start codon and specify methionine. 5’-AAUUCAUGCCCAAAUUUGGGGCACGAAGCUUCUUAGGCUAGUCCUAAAAAA-3’: (2) (a) Using the codon table, show the consequences of adenine base addition to thebeginning of the following coding sequence on the subsequent translation. CGA-UCG-GAA-CCA-CGU-GAU-AAG-CAU asap
- Translation is the process by which the sets of 3 bases (codons) of the mRNA are read to specify the sequence of amino acids for the protein to be produced. Using the genetic code data provided, find the sequence of amino acids that would correspond to the MRNA codons shown. Codons 1 3 MRNA A UGUGGAUC CGAG UCACG Amino acid SECOND LETTER A U UUU Phenylalanine UCU UCC Serine (S) UAU Tyrosine (Y) UAC TAA stop codon UAG stop codon UGU Cysteine (C) UGC TỮA Leucine (L) TGA stop codon UGG Tryptophan (W) F UCA UUG UCG I H CUU CCU CAU Histidine (H) R CGU CỨC Leucine (L) CỦA CCC Proline (P) ССА CCG CGC Arginine (R) CGA CAC "CAA Glutamine CAG (Q CUG CGG G D A AUU L AUC Isoleucine (1) AAU Asparagine AAC (N) ÄÄÄ Lysine (K) AGU Senine (S) ACU ACC Threonine ACA (T) AGC E AUA AGA Arginine (R) E ACG T AUG stat codon (M) AAG AGG TG GƯỮ GAU Apartic acid GAC (D) "GAÄ Glutamic acid GCU GGU GUC Valine (V) GUA GGC Glycine (0) GCC Alanine (A) CE GCA GGA R GUG GCG GGG GAG (E) The start codonencodes the amino…Given the following mRNA and amino acids, construct a polypeptide from this tRNA strand. tRNA UAA CCA UUA UAA mRNA Amino Acids AUU = isoleucine AAU = asparginine GGU = glycine GUC = valine GAG = glutamic acidThe genetic code consists of a series of three-base wordsthat each code for a given amino acid.(a) Using the selections from the genetic code shown below, de-termine the amino acid sequence coded by the following seg-ment of RNA: UCCACAGCCUAUAUGGCAAACUUGAAG AUG= methionine ;CCU= proline; CAU= histidine ;UGG= tryptophan AAG= lysine ; UAU= tyrosine ;GCC= alanine ;UUG= leucine ;CGG= arginine ;UGU= cysteine ;AAC =asparagine ;ACA=threonine ;UCC= serine ;GCA=alanine ;UCA=serine(b) What is the complementary DNA sequence from which this RNA sequence was made? (c) If you were sequencing the DNA fragment in part (b), how many complementary chain pieces would you obtain in the tube containing ddATP?
- Illustrate the process of translation by providing the correct bases for tRNA strand given the mRNA template strand. (Remember that mRNA has uracil instead of thymine.) Template Strand: GCUAUGUUUFor the following mRNA sequence (reading from left to right) what will be the amino acid sequence following translation? (Use chart provided) AUGCCAGUUGAAUAA First position U C A UUU UUC UUA UUG CUU CUC CUA CUG U >Phe GUU GUC GUA GUG >Leu >Leu AUU ACU AUC lle ACC AUA ACA AUG Met/start ACG >Val UCU UCC UCA UCG ©2019 Pearson Education, Inc. CCU CCC CCA CCG GCU GCC GCA GCG Second position A >Ser >Pro Thr >Ala UAU UGU U UAC UGC C UAA Stop UGA Stop A UAG Stop UGG Trp G CAU CAC CAA CAG AAU AAC AAA AAG GAU GAC GAA GAG Tyr >His >Gin >Asn >Lys >Asp >Glu CGU CGC CGA CGG AGU AGC AGA AGG G GGU GGC GGA GGG >Cys Arg >Ser >Arg >Gly DOAG SCAG U с А UCA с А G Third position Correct answer not given Met-Val-Tyr-Pro Met-His-Phe-Ala-Arg Pro-Val-Met-Leu-His Met-Pro-Val-GluThe following segment of DNA codes a protein. The uppercase letters represent Exons, the lowercase letters introns. Draw the pre- mRNA, the mature mRNA and translate the codons using the genetic code to form the protein. Identify the 5’UTR and 3UTR 5’- AGGAAATGAAATGCCAgaattgccggatgacGGTCAGCaatcgaGCACATTTGTGATTTACCGT-3’