What is the effect of incubating a mixture of RNA and DNA with 0.1 M NaOH? A. DNA is hydrolyzed to nucleoside monophosphates. B. No effect. RNA and DNA are resistant to base hydrolysis. C. RNA is hydrolyzed to nucleoside monophosphates. D. Both RNA and DNA are hydrolyzed to nucleoside monophosphates. Stem-loop structures in RNA resemble the ________ form of double-helical DNA. A. A B. B C. supercoiled circular D. Z

What is the effect of incubating a mixture of RNA and DNA with 0.1 M NaOH? A. DNA is hydrolyzed to nucleoside monophosphates. B. No effect. RNA and DNA are resistant to base hydrolysis. C. RNA is hydrolyzed to nucleoside monophosphates. D. Both RNA and DNA are hydrolyzed to nucleoside monophosphates. Stem-loop structures in RNA resemble the ________ form of double-helical DNA. A. A B. B C. supercoiled circular D. Z

Essentials of Pharmacology for Health Professions

7th Edition

ISBN:9781305441620

Author:WOODROW

Publisher:WOODROW

Chapter14: Antineoplastic Drugs

Section: Chapter Questions

Problem 11CRQ

See similar textbooks

Similar questions

The following is diagram of a generalized tetranucleotide. Carbons exist at corners on the shapes and phosphate groups are filled circles. A. Is this a DNA or an RNA Molecule? B. Where is the 3’ end of this tetranucleotide? C. Given that the DNA strand which served as a template for the synthesis of this tetranucleotide was composed of the bases 5’-ACAG-3’, where are the expected bases?
What is the role of ribosomes in protein synthesis? * A. they carry proteins to the site of action B. they provide a source of amino acids C. they provide a site from tRNAs to link to mRNAs D. they translate the basic DNA code using tRNA Consider the following DNA bases sequence 3' TAT CGG 5'. what dipeptide is formed if a DNA point mutation converts CGG to CGT? * A. Val-Ala B. Asp-Glu C. Ala- Ala D. Gly-Ala A tRNA molecule possesses the anticodon 5' CGU 3' , which amino acid will this tRNA molecule carry? * A. Threonine B. Valine C. Alanine D. Arginine What will most likely be the effect of the change in the DNA molecule? * A. the change will cause a harmful mutation B. the DNA molecule will be unable to replicate…
In a melting profile for DNA, the absorbance at 260 nm increases as result of the disruption of the DNA structure. What is the fundamental physical basis for the absorbance increase? a. the effective concentration of DNA changes b. the absorbance of DNA is highly sensitive to temperature c. native DNA absorbs light more strongly than denatured DNA because the bases are stacked d. denatured DNA absorbs light more strongly than native DNA because the bases have become unstacked
1. In a sample solution given for analysis; CATAGCTTTGTTAAA (DNA nucleotide chain). a) Show the 5 'and 3' ends by writing in triplet (codon) form. Find the number of Hydrogen bonds in the double helix DNA strand at the beginning. b) Find the peptide sequence that this DNA chain will synthesize and show the energy balance required for its synthesis and indicate its total load at physiological pH. c) How do you prove that this peptide sequence is as above? Explain.
Ethidium Bromide is a chemical reagent that has been used to detect the presence of nucleic acids. It is known to fluoresce under UV light and the intensity of the fluoresence increases when it binds to the nucleic acids. Ethidium Bromide binds to polynucleotides a by binding directly to the bases on one of the strands. b by intercalating itself between the base pair stacks. c through the negatively charged phosphate groups. d through the hydroxyl group of the sugar molecule.
Evaluate the following statements. Which one statement is false? a. The active form of prokaryotic RNA polymerase is a haloenzyme. b. Anti-codons are a nucleotide triplet in transfer RNA that are complementary and antiparallel to the codons of messenger RNA c. During translation, the terminal carboxyl group of an existing peptide will form a peptide bond with the next amino acid in sequence. d. The amino acid R-group is necessary for the formation of tertiary and quaternary structures through covalent bonds, ionic bonds, hydrogen bonds, and hydrophobic interactions. e. The sigma factors of prokaryotes are responsible for binding a DNA promotor sequence so translation can begin. f. The terminal carboxyl and terminal amino groups of amino acids within a peptide are necessary for the formation of secondary structures through hydrogen bonds. g. A restriction enzyme can target supercoiled, relaxed, or linearized plasmid DNA. h.…
Suppose the following base sequence was found in a 20-base DNA polymer. 3'CAGTTACGGCTCCTAGGTTATAATTCGTTTC 5' a. What would be the first 5 bases at the 3' end of the complementary strand? b. What would be the first 10 bases at the 5' end of the complementary strand? c. Assuming the presence of the complementary strand, what is the percentage composition of the polymer with respect to the A-T base pair? with respect to the G-C base pair? d. In the given segment in problem 1, illustrate and indicate the direction of the synthesis of: i. a 5-nucleotide RNA primer ii. a 5-nucleotide Okazaki fragment
1.1 What is the best description of a Ribosome? a. An enzyme that uses ribose to synthesize amino acids b. A protein/RNA complex that synthesizes protein c. A ribozyme that uses RNA as an enzyme to directly ligate free amino acids to tRNAs d. A multi-subunit protein complex that charges tRNA with amino acids 1.2 In RNA processing? A. Exons are added to the ends of mRNA for protection B. Intron sequences are removed before the mRNA is translated C. The RNA transcript that leaves the nucleus may be much longer than the original primary transcript D. All RNA transcripts will be processed and leave the nucleus.
Some antibiotic drugs fight infection by interfering with DNA replication, transcription, or translation in bacteria. Indicate whether each of the following antibiotic drug effects is on replication, transcription, or translation. HINT Each answer (replication, transcription, and translation) is used only once for the following: a. Rifampin binds to bacterial RNA polymerase. b. Streptomycin binds bacterial ribosomes, disabling them. c. Quinolone blocks an enzyme that prevents bacterial DNA from unwinding.
Consider the following DNA sequence:CATGTGTAGTCTAAAa. Write the sequence of the DNA strand that would be repli-cated from this one.b. Write the sequence of the RNA molecule that would betranscribed from the DNA strand.c. State how many codons the sequence specifies.d. State how many amino acids the sequence specifies
Why is Sanger sequencing referred to as the chain termination method? Select one: a. Sugars on ddNTP lack 3' OH, which prevents the binding of the next nucleotide b. Sugars on the ddNTP have an OH in the 3', which catalyzes the cleavage of phosphodiester bonds c. Sugars on ddNTP lack 5' OH, which prevents the binding of the next nucleotide d. Bases on ddNTP lack 3'OH, which prevents the binding of the next nucleotide Bases on ddNTP lack 5' OH, which catalyzes the cleavage of the phosphodiester bond е.
Read and analyze the question and choices CAREFULLY; more importantly, ALWAYS CHOOSE the BEST answer. How are deoxyribonucleoside triphosphates (precursors of daughter DNA strands) and ribonucleoside triphosphates (precursors of RNA strand) differ from each other? O A. Deoxyribonucleoside triphosphates have an additional sugar residue at the 2' carbon (carbon number 2) in its deoxyribose. Meanwhile, an amino acid residue is not attached at the 2' carbon of ribonucleoside triphosphates in its ribose. O B. Deoxyribonucleoside triphosphates have an oxygen atom at the 2' carbon (carbon number 2) in its deoxyribose. Meanwhile, an oxygen atom is not attached at the 2' carbon of ribonucleoside triphosphates in its ribose. OC Deoxyribonucleoside triphosphates have an amino acid residue at the 2' carbon (carbon number 2) of in deoxyribose. Meanwhile, an oxygen atom is not attached at the 2' carbon of ribonucleoside triphosphates in its ribose. OD. Deoxyribonucleoside triphosphates do not have…