what will happen if an eyeglasses has: a. two converging lens (explain) b. two diverging lens (explain) c. both converging and diverging lens (explain) P.S. This is not a multiple choice question thank You
Q: Think about the pattern of human dispersal. Given what you know about the founder effect, would you…
A: Introduction The term "population" usually refers to the number of people living in a specific area,…
Q: 21 Explain the process of photorespiration.
A: Photorespiration is the light dependent process of oxygenation of ribulose bisphosphate (RuBP) and…
Q: 6. Draw changes in potential in the wet bone during cyclic compression. 7. Can the flow potential be…
A: There are few important points that should be kept in mind : As we know that bone tissue consist of…
Q: Which are true regarding tick-borne bacterial diseases? Select all that apply. - One example is the…
A: Tick borne diseases, that affect the human and other animals, are caused by pathogens transmitted…
Q: major life zones characterized by vegetation and climate, primanly average temperature and…
A: Tropical regions contain tropical forest. These are characterized by hot temperatures all the year…
Q: In a tautomeric shift Multiple Choice it is always adenine that is changed. final bonding…
A: Nucleic acid bases exhibit keto-enol and amino-imino prototropic tautomerism due to the presence of…
Q: Which of the following is NOT true of miRNAs? A. Pri-miRNAs are processed by Drosha in the…
A: A microRNA, also known as a miRNA, is a single-stranded, non-coding RNA molecule that is very small.…
Q: diagram that explains the core concept of flow down gradients in the urinary system/kidneys?
A: Urinary system The urinary system comprises the kidneys, urinary bladder, ureters and urethra. Its…
Q: Define and describe the stressors that may induce Artemia cysts to a state of dormancy How does the…
A: Introduction Artemia, popularly known as brine shrimp, is a genus of aquatic crustaceans. Artemia is…
Q: What evidence implicates mutagenic chemicals from the outside the body in carcinogenesis, and how…
A: Cancer is the product of a process involving complex interactions between environmental and…
Q: he arteries that pass through the heart muscle are necessary for delivering enough oxygenated blood…
A: When the pressure inside the arteries is less than the pressure outside the arteries (due to…
Q: Name the three divisions (parts of the ear).
A: We will answer the first question as exact one question is not specified. Please send back the…
Q: Derive an explanation of a human genetic disorder.
A: A genetic disorder the kind of disorder that is due to the mutation in a single gene. Mutations are…
Q: 6 If exposure to a more acidic pH caused a decline in some sea urchin populations, how might this…
A: Ocean acidification is sometimes referred to as "climate change's equally wicked twin," and with…
Q: Analyze the graphs below. Which growth model (exponential or logis- tic) would apply to a population…
A: Population growth Population growth can be defined as the increase in the number of organisms in a…
Q: Which is NOT a modification made to pre-mRNA? addition of a 5' cap removal of introns addition of a…
A: In bacteria, RNA transcripts are ready to act as messenger RNAs and get translated into proteins…
Q: 2.) One experimental tool used in the biological research and in clinical settings is called…
A: FACS/ Fluorescence-activated cell sorting (FACS) is a specialized type of flow cytometry, which…
Q: Describe the the levels of chromatic packing in an interphase nucleus.
A: Introduction Chromatin is a DNA-protein complex found in eukaryotic cells. The principal role is to…
Q: Helping tags: Biology, microbiology, outbreak, botulism WILL UPVOTE, just pls help me answer the…
A: Botulism is a condition that affects the nerve system and can be lethal. Toxic compounds called…
Q: Glycophorin, a protein in the plasma membraneof the red blood cell, normally exists as a homodimer…
A: Hydrophobic means water repelling. There are certain amino acids in a protein which poses…
Q: he ability to multiplex the PCR reactions used in STR analysis (many PCR amplifications occurring in…
A: Dr.Kary Mullis invented the polymerase chain reaction (PCR) in 1983. The enzyme used in this…
Q: Identify a passive tissue that could be exposed to continued plastic stress (deformation). Explain…
A: Passive tissues are those that suffer muscle contraction when they are not stimulated to stretch but…
Q: To explain: Why professional gardeners soak their seeds in hydrogen peroxide before planting.
A: Seeds inside each fruit are designed to germinate and grow into a new plant on their own, a process…
Q: How do protists vary in their means of obtaining nutrients?
A: Introduction :- Algae, amoebas, euglena, plasmodium, and slime moulds are examples of protists.…
Q: homozygous for his teeth, what are the chances of passing on his toothy smile to thor 22. Some…
A: Teeth is encoded by single gene. The single gene has two alleles. T and t are two alleles of a…
Q: Consider a species in which females are more likely to breed and have successful offspring than…
A: As we know animal breeding is a type of selective breeding of domestic animals whose goal is to…
Q: 12. The CFTR gene, on hu chloride ion concentrat cystic fibrosis. How ma In G1 of the cell cycle In…
A: Phase Number of gene/chromosomes G1 phase of cell cycle- 2 copy G2 phase of cell cycle…
Q: Blue feather color is dominant to brown feather color. Which of the following statements is true…
A: Dominant and Recessive alleles Dominant alleles are those that mask the expression of other alleles…
Q: What features distinguish the amoebozoa from the rhizarians?
A: Protists are the unicellular organisms that are eukaryotes.
Q: A _______ response is when the immune system responds faster upon second encounter with an antigen.
A:
Q: Summarize the basic features of excavates and distinguish among diplomonads, parabasilids, and…
A: Protists are unicellular eukaryotic organisms.
Q: During media preparation, you observed that the agar medium did not solidify after sterilization…
A: Nutrient Agar Medium is the artificial media which is used to grow microbes. It provides essential…
Q: List down several concepts that the society or human being benefit from biodiversity.
A: Biodiversity is the different types of life forms that we see around us. It includes species as well…
Q: Olivia is a wilderness tour guide and spends her day hiking in the mountains. She uses 412 moles of…
A: As per question, Olivia uses 412 mol of ATP. The source of ATPs to be considered are the fats…
Q: State the three main functions of the digestive system.
A: Digestion involves two aspects- mechanical digestion and chemical digestion. Mechanical digestion is…
Q: Assume you want to make and study fragments of a protein. Would you expect that any fragment of the…
A: Proteins are the polymers of amino acids.
Q: 6. You perform a high throughput DNA sequencing reaction on chromosome number 1 from a newly…
A: a)Arranging the fragments with overlapping sequences on the fragments ends. 2.GGCTATTTCGCCG 4.…
Q: Explain the total yield of ATP from aerobic respiration in three different stages of cellular…
A: The three stages of cellular respiration are - 1) Glycolysis - It is a step of breaking down 1…
Q: This protein adduct can hold (tether) a peripheral membrane protein to the cell membrane: A) A fatty…
A: Ionic linkages peripheral membrane protein or interactions with the polar head regions of the…
Q: What character does the term rhizarian indicate about the forams and actinopods?
A: Rhizaria are an ill-defined, species-rich supergroup consists mostly of unicellular eukaryotes.…
Q: A previously healthy female patient presents with fatigue and insomnia. An examination shows she is…
A: The above clinical presentation is a typical of a provisional diagnosis of Iron deficiency anemia.…
Q: Why do some biologists think that the apicomplexans descended from dinoflagellates?
A: The finding of a nonphotosynthetic plastid in malaria and other apicomplexan pathogens has prompted…
Q: What is the most probable cause of the patient’s elevated urea nitrogen?
A: The patient has the conditions of chronic renal failure, diabetes, heart failure, anaemia, HTN. The…
Q: Flow cytometry analysis (FACS) is often done on patient cells isolated from bone marrow or blood.…
A: To identify: To identify the appropriate cell marker that is used to identify from cancers like…
Q: Explain what is meant by the statement "Metabotropic receptors act via second messengers."
A: Metabotropic receptors: Metabotropic receptors is also known as G-protein coupled receptor that…
Q: Human Biology- MILESTONE 6 X P genetics-and-biotechnology-glo O…
A: As we know that mutation is defined as the sudden heritable change in the sequence of an organism…
Q: cribe in detail the mechanism of action of memantine in the treatment of Alzheimer’s Disease.
A: Alzheimer's disease is defined as a medical condition in which an individual finds it difficult to…
Q: You work for a large biotechnology company that is studying viruses, vaccines, and small molecule…
A: There are few important points that should be kept in mind : Viruses are simple ,noncellular and…
Q: 5. What is the correct reading frame for the following mRNA? MRNA 5' GGCACUUAUGCGAUGCCUUGAGUGACCAU…
A: mRNA is made from DNA by the process of Transcription.
Q: Which group of bacteria contains the gram-positive, anaerobic bacterium that causes botulism? (a)…
A: Introduction :- Bacteria having thick cell walls are known as Gram-positive bacteria. These…
what will happen if an eyeglasses has:
a. two converging lens (explain)
b. two diverging lens (explain)
c. both converging and diverging lens (explain)
P.S. This is not a multiple choice question thank You
Step by step
Solved in 3 steps
- Madam Ojo, age 60, comes to the eye clinic for a routine eye examination. I. Describe the procedure for checking visual acuity. II. If the ophthalmic nurse records 6/60 for Madam Ojo’s visual acuity, how would you explain this visual acuity score to a first-year nursing student?A patient’s visual acuity is assessed as 20/40 in both eyesusing the Snellen chart. The nurse interprets this finding as:a. The patient can see twice as well as normal.b. The patient has double vision.c. The patient has less than normal vision.d. The patient has normal vision.JJ is a 75 yo female patient with asymptomatic open angle glaucoma with elevated IOP >25%. They have no other pertinent medical conditions. The ophthalmologist spoke with them about treatment options and they prefer to try pharmacologic therapy before laser therapy. Which TWO of the following treatment options are considered first line therapies? No partial credit. a. bimatoprost (Lumigan) b. dorzolamide (Trusopt) c. pilocarpine (Isopto Carpine) d. brimonidine (Alphagan P) e. levobunolol (Betagan)
- Match the function with the correct structure. 1. Absorbs scattered light Sclera 2. Photoreceptors of the retina responsible for Vitreous humour colour vision 3. Refracts light rays into the eye Ciliary muscles 4. Supports the eyeball with the fluid they Iris contain 5. Alters the shape of the lens to promote Cones focusing Lens 6. Protects and supports the eyeball 7. Area that contains a high density of cones Choroid 8. Photoreceptors of the retina sensitive to dim Fovea centralis light 9. Focuses the light rays on the fovea centralis Rods 10. Regulates the amount of light that enters Cornea the eyeDiseussion: What is the microexamination, why it is used and what is the difference between macro and microexamination? 2. state the purpose of the followings: Coarse adjustment knob, b. Fine adjustment knob, e. Iris diaphragm. d. Objective lens. e. Ocuiar or eye lens. Lengith, e 3. If the approximate magnification when using an objective lens with a focal Y re length of (2mm) is (800X), what is the magnification of the eye lens. 4. Calculate the focal length of the objective lens for a microscope with an approximate magnification of (1000x) and an eye lens magnification of (10x). * 5. Explain briefly the microscope work mechanism to examine a specimen prépared for microexamination.Identify the following structures and sketch them in the spaces provided: 1. Cornea 2. Anterior cavity containing aqueous humor 3. Iris 4. Pupil 5. Lens 6. Zonular fibers of the lens 7. Ciliary body a. Ciliary processes b. Ciliary muscle 8. Vitreous chamber containing vitreous body 9. Sclera 10. Choroid 11. Retina a. Macula lutea i. Fovea centralis b. Rods c. Cones 12. Optic disc 13. Optic nerve (cranial nerve II) 14. Primary visual cortex of the brain
- Many conditions affect the eyes. Hyperopia, myopia, and astigmatism are three conditions that can be corrected easily using prescription eyeglasses. Laser surgery can permanently modify the shape of the cornea. Which of the following rows identify the correct types of technologies to correct each condition? Select one: а. Нуperopia Мyopia Astigmatism 1. Concave lens 1. Convex lens 1. Corrective lens that corrects 2. Laser surgery to 2. Laser surgery to increase the uneven corneal surface make the cornea the curvature of the 2. Laser surgery to make the flatter cornea corneal curvature even b. Нуperopia Мyopia Astigmatism 1. Convex lens 1. Concave lens 1. Corrective lens that corrects 2. Laser surgery to increase 2. Laser surgery to the uneven corneal surface the curvature of the make the cornea 2. Laser surgery to make the cornea flatter corneal curvature even С. Нуperopia Мyopia Astigmatism 1. Concave lens 1. Convex lens 1. Replacing the lens 2. Laser surgery to 2. Laser surgery to…Explain the process of phototransduction and signal transmission in the retina. Be sure to include the steps associated with the formation/breakdown of Rhodopsin as well as the signal transduction process that takes place in the retina beginning in the dark. Be sure to also include where in the retina these process are taking place (i.e rods, bipolar cells or ganglion cells, outer segment, inner segment…).The indication of Instilling a sterile ophthalmic solution such as liquid tears and saline every 3-4 hours to comatose patients is to, a. To destroy microorganisms in the eye b. Restore blink reflex c. Prevent corneal drying and ulceration d. Prevent cross contamination from one eye to the other