Which enzyme regulates the rate at which acetyl-CoA enters the citrate cycle? isocitrate dehydrogenase pyruvate dehydrogenase citrate synthase a-ketoglutarate dehydrogenase
Q: in a specrophotometry ethanol determination experiment, you measured OD340 and assumed this…
A: Nicotinamide adenine dinucleotide: The molecules nicotinamide adenine dinucleotide (NAD) and…
Q: 15-24 b) c) Identify the molecules oxidized and reduced in the following reactions: a) CH₂CH₂CHO +…
A: Many redox reactions occur during metabolism. Redox reactions necessitate the transfer or removal of…
Q: Why is the name the "citrate cycle" a more accurate name for the metabolic pathway discovered by…
A: Critic acid cycle also called as tricarboxylic acid cycle is the second stage in aerobic cellular…
Q: Which monosaccharide(s) seen below is(are) an epimer of the structure on the left? H- НО Н- H CHO О…
A: Two isomers that are correlated to one another by reflection are called optical isomers or…
Q: Exam pe reaction That require energy Catabolic Allosteric site ADP+POATP Entropy increases 2nd law…
A: Enzymes are catalysts that speed up biochemical reaction. These are workable under particular…
Q: Two villages in the Amazon depend on corn as a major staple in their diet. People in village A have…
A: Pellagra is a deficiency disease which is characterised by diarrhoea, mental disturbance, scaly…
Q: With regards to hemoglobin-oxygen binding, CO2 is a [Select] modulator and 2,3-bisphosphoglycerate…
A: Positive allosteric modulators of haemoglobin -oxygen binding are the agents that stabilise R state…
Q: Which of the following is a second messenger that ultimately causes inhibition of glycogen synthase?
A: Glycogen synthase - is a key enzyme of glycogenesis and also called as UDP- glucosyltransferase. GS…
Q: 3. After 24 hours of fermentation, no more CO₂ was produced in the presence of sucrose. Assuming…
A: Yeast performs alcoholic fermentation. Alcoholic fermentation is the process by which certain sugars…
Q: In its non-phosphorylated state, glycogen phosphorylase can be activated by which of the following…
A: Glycogen phosphorylase is the regulatory enzyme of the glycogenolysis pathway. Glycogenolysis is the…
Q: Biologically important steroids: (sterols – cholesterol and its derivatives, bile acids, steroid…
A: Steroids are derivatives of Cyclopentanoperhydrophenanthrene ring containing compounds. They have…
Q: is this protein folding funnel from a metamorphic protein? yes or no? is there one intermediate…
A: Anfinsen hypothesis postulates that under native conditions, the three-dimensional structure of a…
Q: 1 the concentration of the enzyme competition inhibitor was 1×10-3M. If 1 µmol of the inhibitor is…
A: The inhibitor is a competitive inhibitor, as can be seen from the table. The activity of enzymes…
Q: . Effects of amino acid composition and sequence to protein folding
A: Amino acids are the building blocks of proteins which are composed of amino group (NH3+), carboxyl…
Q: How much ATP will be produced from the Beta-oxidation of lauric acid a C 12 saturated fatty acid?…
A: Lauric acid is a saturated fatty acid with 12 carbon atoms. The molecular formula of lauric acid is…
Q: Which of the following is TRUE under the following conditions: the enzyme concentration is 2.5 nM,…
A: The rate of reaction can be determined by using Michaelis Menten equation. Michaelis Menten equation…
Q: LO43 Identify the levels at which gene expression can be regulated in prokaryotes and eukaryotes…
A: Gene regulation is the process of control of expression genes. This process occurs by several…
Q: 5) The nucleotides in the backbone of DNA are held together by bonds. A) hydrogen B) peptide…
A: Nucleic acids are composed of nucleotides (sugar, nitrogenous base & phosphate group). Nucleic…
Q: A plot of enzyme activity with and without an inhibitor present gave the following. Use two…
A: The rates of biochemical reactions are increased by proteins known as enzymes. Inhibitors are…
Q: Defects in the Citrate Cycle are rare but have been described. Based on the level of metabolites…
A: Glycolysis consists of 10 enzymatically catalysed reactions that convert one 6-carbon molecule of…
Q: Questions 11-13- refer to the carbohydrate mannose (open chain and one anomeric ring configuration…
A: Carbohydrates are polyhydroxy aldehydes or ketones. They can be classified as monosaccharides,…
Q: For each pair of biomolecules, identify the type of reaction (oxidation‑reduction, hydrolysis,…
A: The glycerol is a 3-carbon structure. (C―C―C) To each carbon atom there is attached one -OH group…
Q: 5'- ATTGTGATATGGCCACCTGCCACCTGGAGAGCAGCT GATTAG-3' What oligopeptide is encoded by the above…
A: In our body genetic information is stored in form of DNA. DNA multiples itself by replication. DNA…
Q: ----------------------the simplest lipids but they may be a part of or a source of many complex…
A: Lipids are a chemically diverse group of biomolecules that have two things in common: low…
Q: All lipids are absorbed into absorptive cells of the small intestine by which process? Primary…
A: The biological membrane that surrounds a living cell is called the cell membrane. The structure of…
Q: In an enzyme mechanism that generates a negative charge in the transition state, which of the…
A: When a substrate(S) binds to the active site of an enzyme(E), it leads to the formation of an ES…
Q: Reaction of alkaline, acid and enzymatic hydrolysis of triacylglycerols.
A: Triacyl glycerols are triglycerides which are formed from 3 molecules of fatty acids and one…
Q: IV. Write on the first column the monosaccharide unit(s) that is present in the given disaccharide.…
A: Carbohydrates are polyhydroxy aldehyde or ketone or produce similar units on hydrolysis. The basic…
Q: What is the isoelectric point of the following peptide molecule?…
A: The pH at which a specific molecule carries no net electrical charge is known as the isoelectric…
Q: A scientist made mistakes during DNA extraction. On his first attempt, he blended the sample too…
A: Blending is done when DNA is to be extracted from multicellular samples like tissues of animals and…
Q: Coupling ATP hydrolysis to glucose phosphorylation makes thermodynamic sense, but consider how the…
A: The two individual reactions i.e. glucose phosphorylation and ATP hydrolysis is given below, along…
Q: How many ATPs are generated in the reaction: Glucose to oxidation to 2 acetyl CoA via Glycerol…
A: A redox reaction is where oxidation and reduction occur simultaneously. In glycolysis, there is a…
Q: What are the biochemical cycles?
A: Biochemistry is the way of understanding of different chemical reactions that occur within the…
Q: what is does the induced -fit model account for? 2 why are most enzyme inactive at higher…
A: Enzymes are high molecular-weight protein molecules that catalyse biochemical reactions. The…
Q: Why is RNA splicing important to cellular processes and protein synthesis?
A: As per the central dogma of molecular biology, DNA contains the information needed to synthesize…
Q: Complete the following reaction: P680 + light →_______→ O P680*; P680 + H+ O P680*; P680* + e O…
A: The P680 reaction center is a part of photosystem II. Upon getting hit by photons, P680 gets…
Q: 5'- ATTGTGATATGGCCACCTGCCACCTGGAGAGCAGCT GATTAG-3' What oligopeptide is encoded by the above…
A: The DNA contain genes (functional unit) that encode protein molecules. Proteins are the "workhorses"…
Q: OOC 1 H₂C H₂C H₂C-C HC H₂C NH NO HN Coo 1 CH₂ T CH₂ C-CH, CH C-CH₂ G=CH₂ "OOC 1 H₂C H₂C T H₂C H₂C-C…
A: Hemoglobin has four subunits, in which each has a heme group. The heme group is a heterocyclic…
Q: Is increasing the P; concentration a reasonable way to couple ATP hydrolysis and glucose…
A: It makes sense to relate ATP hydrolysis and glucose phosphorylation by increasing the P…
Q: A certain metabolic pathway can be diagrammed as: X Y A B C D where A, B, C, and D are the metabolic…
A: Metabolism is the total of all chemical transformation that takes place in a living cell. One…
Q: For each of the metabolic transformations (a) through (d), determine whether the compound on the…
A: The biological oxidation-reduction (redox) reaction involves the transfer of electrons from one…
Q: A new oxygen transport protein that exhibits cooperative binding has been isolated and is being…
A: The Hill equation for O2 binding to a protein can be used to solve this problem. The equation is…
Q: Why was it necessary to use phosphoaminophosphohlc (ANP) in the ATP synthase enzyme active site…
A: ATP (Adenosine triphosphate) is energy molecule which is pretty stable in aqueous solutions at pH…
Q: Calculate the number of moles of ATP produced from the complete oxidation of 900 g glucose in the…
A: Glucose that enters the cell produces ATP by respiration. The processes involved are glycolysis,…
Q: Which enzyme listed below is considered both a component of the citrate cycle and a component of the…
A: Cellular respiration is a collection of three metabolic pathways that generate ATP the energy…
Q: The proton gradient across the inner mitochondrial membrane is produced.... by passing electrons to…
A: ETC consist of four protein complexes called Complex I, II, III and IV that transport electron…
Q: A patient of African American decent came in due to vasooclusive symptoms, you suspect a condition…
A: Hemoglobin is a tetrameric protein that transports oxygen to the tissues and CO2 to the lungs. Each…
Q: 6. A control phospholipid membrane is isolated in which the phospholipid tails all have an 18-C…
A: Phospholipids are major membrane lipids and present as a bilayer structure. It is consist of…
Q: 3.5 An a helical, intracellular protein, ITSME, denatures at 80 degrees Celsius. Which of the…
A: Proteins are polymers of amino acid residues linked together via a peptide bond. The amino acid…
Q: A gerbil is fed a normal diet including 14C-lysine. After a period of time on this diet biopsies are…
A: Gerbils are mammals , so only mammalian metabolism can be used here. In the figure below showing the…
Step by step
Solved in 2 steps
- Which enzyme is used for both the synthesis and breakdown of acetoacetate? thiolase O HMG-CoA synthase OB-hydroxybutyrate dehydrogenase O B-Ketoacyl-CoA transferaseWhat is the final reaction in the final round of fatty acid synthase? Acetyl-CoA ACP Transacylase Beta-Ketoacyl- ACP Synthase Beta-Ketoacyl- ACP Dehydrase Palmitoyl thioesterase Malonyl-CoA ACP Transacylase Enoyl-ACP ReductaseIdentify the Krebs cycle enzyme that consumes a 3-carbon substrate molecule, producing a 2- carbon product molecule (attached to acetyl-CoA), along with NADH, and one molecule of CO2. succinyl CoA synthetase a-ketoglutarate dehydrogenase pyruvate dehydrogenase isocitrate dehydrogenase malate dehydrogenase
- In the pyruvae dehydrogensae complex, acetyl-coa is released by the dihydrolipoyl transacetylase activity. What is the purpose of the following enzymatic activity.In beta-oxidation, which cofactor is required the for second oxidation reaction (conversion of beta-hydroxyacyl-CoA to beta-ketoacyl-CoA)? NAD+ water FAD CoA-SHEnzyme involved in the synthesis of the compound forming bile salts and steroid hormones Acetyl CoA carboxylase HMG-COA reductase (mitochondrial) O HMG-COA reductase (cytosolic) Acetyl CoA reductase
- What enzyme will not be used if the oxidative portion of the pentose phosphate pathway is operating to produce ribose 5-phosphate? Ribulose 5-phosphate isomerase 6-phosphoglucono-lactonase 6-phosphogluconate dehydrogenase TransaldolaseWhich enzyme catalyzes a freely reversible reaction? Pyruvate dehydrogenase Aconitase α-Ketoglutarate dehydrogenase Citrate synthase Please select only one answer.What is the rate-limiting step in the synthesis of acetyl CoA? oxidation regeneration of lipoamide decarboxylation transfer to lipoamide transfer to CoA
- Which of the following Krebs cycle enzymes generates a molecule of FADH2 from FAD? a-ketoglutarate dehydrogenase pyruvate dehydrogenase isocitrate dehydrogenase malate dehydrogenase succinate dehydrogenaseWhich enzyme involved in the breakdown of fatty acids requires activated vitamin B12? methylmalonyl-CoA mutase O propionyl-CoA carboxylase O acyl-CoA dehydrogenase enoyl-CoA isomeraseAll of the following enzymes catalyze a committed step EXCEPT: HMG-CoA reductase Fatty acyl-CoA synthetase Acetyl-CoA carboxylase I Pyruvate dehydrogenase complex All of the above enzymes catalyze a committed step The brain can directly use all of the following chemicals as energy source EXCEPT: Acetoacetate b-hydroxybutyrate Glucose Fatty acids All of the above can directly be used by the brain as energy source