Which of the following is not a correct description of tissue pathology? Neurilemmoma is a very homogenous tumor, consisting of primarily of Schwann cells. Cirrhosis involves the formation of nodules, or lumps, of regenerating liver cells. Anthracosis involves the accumulation of coal dust in the lungs. Osteogenic sarcoma involves the presence of cancer cells near the growth plate of bone
Q: how does boidiversity depend on a species ability to reproduce
A: Introduction Biodiversity refers to the variety of species like plants, animals, bacteria, and…
Q: Which of the following is/are true about the epidemiologic transition hypothesized for economically…
A: Epidemiologic transition, the process by which the pattern of mortality and illness in a population…
Q: The difference between whole body metabolic rate and weight specific metabolic rate. How does…
A: Allometry is an important method for describing morphological evolution. It is the relation between…
Q: TRUE / FALSE. Based on the proportion of the U.S. population having each blood type, it’s reasonable…
A: The most common blood type in the US is O-positive, with around 38 percent of the population having…
Q: Describe the three major steps in the Calvin cycle and the role of the key enzyme rubisco.
A: The three crucial phases of the light-independent processes in photosynthesis are referred to as the…
Q: What vaccines are available to prevent viral hepatitis?
A: Introduction Hepatitis virus as the name suggests affects the liver, Hepatocytes, and itis means…
Q: 5. Protein and blood cells are not found in the urine of healthy individuals. Patients with kidney…
A: Introduction Kidneys are the primary excretory organs in humans. They are associated with the…
Q: CCAGAGGTC Replicate this DNA (answer in CAPS)
A:
Q: . Write complete sentences using each of thefollowing terms to correctly describe the…
A: The science of nomenclature involves giving organisms names. The names are distinctive and…
Q: What does the term "lentivirus" mean? OA virus that inserts its DNA into the host's DNA Oa virus…
A: Introduction: Lentivirus is any of a group of retroviruses that produce illnesses which is…
Q: If an enzyme is functioning at 75% of Vmax, the substrate concentration must be than the Km of the…
A: Introduction: Proteins called enzymes aid in accelerating the body's chemical reactions, or…
Q: Which of the following statements is FALSE about the long-term evolution experiment (LTEE) that you…
A: Introduction Evolution is the gradual change in the inherited traits of biological populations over…
Q: true-breeding white and the F1 generation is all orange. He collects more data by combining an…
A:
Q: You wish to produce a high-value protein using recombinant DNA technology. Would you try to develop…
A: as per our company guidelines we are supposed to answer only first 3 parts. Kindly repost other…
Q: Why is the ovary the most essential female reproductive organ?
A: Reproductive system is the organ system that is aimed at producing gametes. Female reproductive…
Q: Explain the following areas about (MRI device) 1. What are the ingredients? The device? 2. The…
A: INTRODUCTION MRI:- Radiologists employ magnetic resonance imaging (MRI) as a medical imaging…
Q: Please help me understand this question
A: Introduction Biomolecules are generally found in the complex form such as in the polymer stage even…
Q: 7. If you have aligned orthologous gene sequences from an important, conserved gene; there is a…
A: When two species diverge into two separate species, the copies of a single gene in the two resulting…
Q: Explain the following areas about (X-ray machines) 1. What are the ingredients the device? 2.…
A: The development of CT and the discovery of X-rays both marked significant developments in medicine.…
Q: The most significant cause of the loss of biodiversity isa. habitat loss.b. pollution.c. exotic…
A: Introduction Biodiversity refers to the availability of the different types of species of different…
Q: 2. Why are images observed under the microscope inverted and reversed?
A: Introduction Microbiology is the study of microorganisms, which are unicellular or cell-cluster…
Q: Cytoplasmic extensions of_______ send and receive chemical messages.a. glial cells c. fibroblastsb.…
A: Introduction The nervous system is the main controlling center of the body which controls all…
Q: The purpose of mitosis in human cells is for the production of two diploid, _________________ cells.
A: Cell division is a metabolic phenomenon takes place Inside the cell in which parent cell undergo…
Q: If an enzyme is functioning at 75% of Vmax, the substrate concentration must be. than the Km of the…
A:
Q: In the fungus Neurospora, a strain that is auxotrophic for thiamine (mutant allele t) was crossed…
A: Neurospora is an Ascomycete fungus genus. The genus name, which means "nerve spore," refers to the…
Q: Explain the Calvin cycle in photosynthesis
A: Photosynthesis is the process in which solar energy is used to synthesize complex carbon compounds.…
Q: What do you think will become the top public health concern in 2050, What do you think will become…
A: Answer: Drug-resistant diseases increase day by day. It's major concern for future public health.…
Q: Why do sperm take 12 days to travel the length of the epididymis?
A: The epididymis is a coiled tube that resides behind the testicle and provides a place for sperm to…
Q: Name the major organ systems, and describe thegeneral functions of each.
A: Introduction: There are a lot of cells in the human body. Tissues are a specific class of cells that…
Q: 1. What were the clues that led to the identification of the suspect? 2. What do you think the…
A: Since you have posted a question with multiple subparts, we will solve the first three subparts for…
Q: either loss of responsiveness to a given hormone or production of a continuous signal even in the…
A: Introduction: Mutations which identified in the catalytic subunit (C) of the cAMP-dependent…
Q: Which of the following should not be considered when designing nature reserves?a. edge effects that…
A: A nature reserve is a biological reserve created to preserve wildlife, plants, and animals as well…
Q: n your own words, explain the factors that lead to the Phenotypic variation andits importance to…
A: Evolution is a change in the frequency of alleles in a population over time. These alleles are the…
Q: . Sketch the outline of a human body, and use linesto indicate an example of each of the…
A: Sagittal plane- it is a vertical plane that runs from front to back. Hence it divides the body into…
Q: If the enzyme that catalyzed the reaction that converts pyruvate to acetyl-CoA and carbon dioxide is…
A: The cellular respiration involves in the breakdown of glucose and production of energy in the form…
Q: How about the top two reasons why layering procedures should be used? Provide evidence by citing…
A: Layering is a technique used for the propagation of plants. In this procedure, a stem developed…
Q: What hormones does the ovary produce?
A: Ovaries: Along either sides of the uterus are 2 tiny, oval-shaped glands called the ovaries. Eggs…
Q: Identify the missing components and write their names against the numbers 1-7 given below:
A: Introduction The Wnt pathway is a signal transduction pathway that is known for the regulation of…
Q: 2. "Our study shows that microplastics are an additional vector for exposing fish to micropollutants…
A: According to the European Chemicals Agency and the U.S. National Oceanic and Atmospheric…
Q: 4. Use what you know about the anatomy and physiology of special sensory organs to evaluate how each…
A: we will be discussing how different changes in an animal's anatomy and physiology can impact its…
Q: Drag the identifying traits used to group each new class to the boxes. Start with the most primitive…
A: The dipnoans are generally called 'lung fishes'. The group, Dipnoi owes its name from the presence…
Q: 2. Identify the following structures when given images such as the ones below:
A: Process of Translation :- Translation is the process by which the genetic code contained within a…
Q: Why are Crohn disease and ulcerative colitis called inflammatory bowel diseases?
A: Any section of a person's digestive tract, from the mouth to the anus, might develop Crohn's…
Q: . Which neural processing strategy best describes high frequency sound localization. A. Coincidence…
A: The capacity to pinpoint the position or source of a detected sound in terms of distance and…
Q: If the cell whose nuclear material is shown in figure below continues toward completion of mitosis,…
A: This question is based on the mitosis process of the cell cycle.
Q: For this RNA code, what is the final codon ? UACACGCCAGAGGUCGCCUUUACA
A: Introduction :- a DNA or RNA molecule that codes for a particular amino acid through a group of…
Q: 1) Compare the different hierarchical organizations and/or animal body plans across different…
A: All biological systems are made up of subsystems of various orders that are part of larger…
Q: 1. The antibacterial activity of flavonoids was tested against the bacterial strain, Escherichia…
A: As per our guidelines, we are supposed to answer only three sub-parts. Kindly repost the question…
Q: Chromosomes per cell Chromosomes status DNA (molecules) per cell DNA picograms per cell Ploidy…
A: Chromosome is a structure which is found inside the nucleus of a cell.
Q: Name the seven parts that is responsible for the Breathing Process . Arrange them in order from…
A: Breathing It is defined as the process of facilitating gas exchange. It brings oxygen gas into the…
Trending now
This is a popular solution!
Step by step
Solved in 3 steps
- The cell involved in bone resorption (destroy & remove unwanted bone) is:In the histological study of diaphysis of the tubular bone: there are basophilic cells with synthesized synthesis organelles on the it surface under the fiber layer. These cells are involved in the regeneration of bone tissue. In what layer of diaphyseal are they located? * Periosteum O Layer of internal lamellas O Layer of external lamellas Bone matrix Osteogenic layerJohn Fogelman was diagnosed with having a/an ______________________. This is a malignant tumor that arises from connective tissues, including hard, soft, and liquid tissues.
- A type of cancer that occurs in blood-making cells found in the red bone marrow is known as a/an __________________________. primary bone cancer Ewings sarcoma myeloma osteochondromaBelow you will find a word bank. Each of the terms in this word bank will be a structural feature found in one or more of the tissues listed above. Word bank: Epiphyseal plate Canaliculi Lamellae Lacunae For each term, specify the appropriate tissue or tissues (cartilage, spongy bone or compact bone?) to which it belongs to. For each term, provide a one sentence description of its organization and its function within the tissue.A 25 year old footballer came to you with severe pain in right knee joint. He complains that his knee suddenly gets stuck in the middle of knee ROM. A year ago, while playing football match at a club his same knee got injured. At that time his ACL was injured (Grade 2 Tear). With 6 months of rehabilitation his ACL tear was healed. On examination, there is mild swelling over right knee. His passive ROM is complete. No instability has found. In weight-bearing position rotation of femur causes severe pain. a) What would be the possible diagnosis? b) What is the mechanism of injury of your proposed diagnosis? c) What imaging technique is required to confirm your diagnosis?
- The following is true about cartilage: O It has a solid matrix It has lymph vessels It has 4 types It is very vascular It is a specialized type of C.T With regard to the dorsal root ganglia of spinal nerves They are found within the CNS True Falsein a histological examination, you have the following tissue specimens: (1) Intervertebral disks and symphysis pubis; (2) tendons and ligaments; and (3) tissues from the inner spleen and lymph nodes. How will you categorize these specimens, respectively? O Hyaline, dense regular collagenous, reticular O Fibrocartilage, dense regular collagenous, reticular O Hyaline, dense irregular collagenous, reticular O Elastic cartilage, dense regular collagenous, reticular O Fibrocartilage, dense irregular collagenous, reticular 27 28 29 30 31 32 33 34 35 3Answer the following multiply choice questions don't need to explain? a. Which of the following is NOT a function of the skeletal system? A. Permanently absorbs minerals for strength to protect organs (Maybe) B. Facilitates movement with joints allowing different degrees of movement C. Stores and releases fat D. Supports the body with bone tissue capable of withstanding stress b. This type of skin cancer is the most fatal of all skin cancers due to the high rate of metastasis. It is characterized by uncontrolled growth of the pigment producing cells of the skin, thus usually developing from a mole already present on the skin. A. Basal cell carcinoma B. Sarcoma C. Melanoma D. Squamous cell carcinoma c. What kind of tissue is produced first during long bones formation and then replaced by bone tissue? A. fibrocartilage B. elastic connective tissue C. dense fibrous connective tissue D. hyaline cartilage (Maybe) d. Which of the following is a bone marking name that indicates a hole…
- A cold treatment, specifically an ice massage, has been ordered for 20 minutes for a patient's complaint of chronic pain. Which of the following observations would indicate a complication of tissue intolerance? 1-Redness or inflammation 2- Mottling or graying 3- Burning or tingling or cold 4-Numbness1. How do monosodium urate crystals cause gout to develop? 2. What is the main objective clinical finding in fibromyalgia? 3. How do metabolic muscle diseases develop? What causes them? 4. Name one toxic myopathy and explain why it develops. 5. From what cells do bone tumors originate? 6. Compare five major characteristics of benign bone tumors with those of malignant bone tumors. 7. How does the presence of metastatic tumors affect treatment options and prognosis of persons with osteosarcoma?Match the tissue shown with its function. options: 1. Present in bone marrow, spleen, and lymph nodes.2. Allows us to think.3. Triceps brachii are needed for arm extension.4. Provides a smooth surface.5. Support and binding of other tissues.6. Stores energy in the form of fat.7. Propulsion of food and liquid through gastrointestinal tract.8. Allows the ribcage to be flexible;necessary for breathing to occur.9. Protective,withstands abrasion.10. Secretion (mucus, HCI, etc.), protection, absorption.11. Propels blood through the heart12. Part of skeletal system: support, movement, production of blood cells.13. The only liquid connective tissue. It transports substances and cells.14. Lines tubules in kidneys.15. Allows for elastic recoil of large arteries like the aorta and of alveoli during exhalation.16. Thin for rapid diffusion of gases17. Creates the mucociliary escalator that protects the respiratory system from microbes and debris.