Which of the following statement(s) correctly describe(s) telomerase? Select all that apply. You may select multiple options. ✔Telomerase synthesizes DNA from an RNA template. O All of these options O Telomerase extends the lengths of telomeres of linear chromosomes in eukaryotes. O Telomerase unwinds the DNA duplex at telomeres. Telomerase serves as a primer for DNA synthesis at telomeres. O Telomerase has 5'-to-3' exonuclease activity.

Which of the following statement(s) correctly describe(s) telomerase? Select all that apply. You may select multiple options. ✔Telomerase synthesizes DNA from an RNA template. O All of these options O Telomerase extends the lengths of telomeres of linear chromosomes in eukaryotes. O Telomerase unwinds the DNA duplex at telomeres. Telomerase serves as a primer for DNA synthesis at telomeres. O Telomerase has 5'-to-3' exonuclease activity.

Name: Which of the following statement(s) correctly describe(s) telomerase?
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Which of the following statement(s) correctly describe(s) telomerase? Select allthat apply. You may select multiple options.✔Telomerase synthesizes DNA from an RNA template.O All of these optionsO Telomerase extends the lengths of telomeres of linea

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter11: Genome Alterations: Mutation And Epigenetics

Section: Chapter Questions

Problem 18QP: Replication involves a period of time during which DNA is particularly susceptible to the...

See similar textbooks

Similar questions

You are characterizing a new DNA polymerase. In a test tube, you incubate the enzyme with all the components needed for catalysis, EXCEPT you don't add any dNTPs. However, you notice that some type of catalysis has occurred. What is the most likely product in this case? O The supercoils in the DNA have been relieved O The sugar has been converted from a deoxyribose to a ribose A DNA strand is one base shorter due to nuclease activity The magnesium ion has been converted to a charge of +2 to +1
Which of the following statement(s) is/are false/incorrect? You may select multiple options, if necessary. ☐ Experiments support bidirectional movement of multiple replication forks at eukaryotic chromosomes. O Mg++ ions play important roles during DNA synthesis Synthesis of DNA is semi-conservative ✔ Beta clamp reduces DNA polymerase processivity ✔ DNA polymerase III uses ATP as a source of energy to drive the polymerization reaction forward O Tautomers enhance chances of correct nucleotide incorporation during DNA synthesis
For the following DNA sequence along a chromosome answer the following questions: The enzymes are working 5' ATGCATTAGACCACTAGCAT 3' left to right 3' TACGTAATCTGGTGATCGTA 5' 12. Is the top or bottom the leading strand? 13. On the leading strand only, start with a primer that is 5 nucleotide's long and then finish the rest as DNA polymerase would. Give me the entire strand of only the leading strand. 14. What enzyme copies the DNA by adding DNA nucleotides? 15. What enzyme links Okazaki fragments together on the lagging strand?
Which of the following statements about cellular DNA metabolism is(are) TRUE? A All DNA polymerases have highi fidelity due to their 3:to-5' exonuclease activity aUracil bases appoar in DNA as a result of deamination of cytidine bases OC DNA primase synthesizes a short RNA primer that later appears at the 5 end of each Okazaki tragment. Do. DNA polymerase adds nucieotides to the 3end of a growing DNA strand DESpecial methyltransferase modifies adenines in GATC sequences of the newly synthesized DNA strands for subsequent re- OR Endonucleases are able to degrade both circular ald linear DNA molecules
What does i mean to say that extension by DNA polymerase III proceeds 5' 3'? The 5' end of a DNA polymerase molecule attaches to the 3' end of primase. DNA polymerase adds nucleotides to a growing strand, moving in the 5'-3' direction. O DNA polymerase seals nicks as it moves along a DNA strand toward the 3' end. DNA polymerase can only synthesize DNA at the 5' end of an existing strand of DNA. O O 0
Replication involves a period of time during which DNA is particularly susceptible to the introduction of mutations. If nucleotides can be incorporated into DNA at a rate of 20 nucleotides/second and the human genome contains 3 billion nucleotides, how long will replication take? How is this time reduced so that replication can take place in a few hours?
During DNA replication, one of the new strands of DNA is synthesized continuously, while the other is synthesized as a number of separate fragments of DNA that are subsequently linked by DNA ligase. This is because O replication starts at many points on the chromosome RNA primers only anneal to one of the parental strands of DNA one of the parental strands is unwound slower than the other by helicase DNA polymerase III only synthesizes DNA in the 5' - 3' direction
For the following DNA sequence along a chromosome answer the following questions: The enzymes are working 5' ATGCATTAGACCACTAGCAT 3' left to right 3' TACGTAATCTGGTGATCGTA 5' 13. On the leading strand only, start with a primer that is 5 nucleotide's long and then finish the rest as DNA polymerase would. Give me the entire strand of only the leading strand.
The 5'-3' exonuclease activity involves all the following EXCEPT: o Both ribonucleotides and deoxyribonucleotides can be removed. O DNA repair can also be undertaken by this activity. o Groups of altered nucleotides can also be removed. o Removal of one nucleotide at a time in the properly base paired DNA. o Activity is possessed by both DNA polymerase I and III
Ita person is lacking a gene that codes for a protein involved in nucleotide excision repair, then which of the following statements would be true for that person? Select the answer that is a correct statement. OA. They should avoid smoking because their cells will not be able to repair double stranded breaks caused by the alkylating agents found in cigarette smoke. R They should avoid radiation because their cells will not be able to perform non-homologous end joining to repair double stranded breaks that ionizing radiation causes. C. They should stay out of the sun, because their cells will not be able to repair thymine dimers formed in skin cell DNA caused by UV light. They should not smoke because their cells will not be able to perform homologous recombination to repair thymine dimers caused by alkylating agents in cigarette smoke. E. They shouldn't smoke and they should always use sunscreen, but that's because these are simply healthier ways of living that have nothing to do with…
Would you still need telomeres and telomerase to complete eukaryotic chromosome replication if primase always laid down the RNA primer at the very 3ʹ end of the template for the lagging strand?
FIGURE 19.16 Direct repair of dam- aged bases in DNA. (a) The repair of thymine dimers by photolyase. (b) The repair of methylguanine by the transfer of the methyl group to Thymine dimer CH3 SH 06-Methylguanine CH2 ONLINE ANIMATION Н. CH3 Нас. N- н- Н Н N. `NH2 Alkyltransferase alkyltransferase. CONCEPT CHECK: Which of these DNA backbone Alkyltransferase catalyzes the removal of the methyl group onto itself. repair systems is particularly valuable to plants? DNA DNA photolyase cleaves the 2 backbone bonds between the thymine dimer. CH3 Guanine На 'N' CHз Нас. -- н CH2 н Н `NH2 The normal structure of the 2 thymines is restored. The normal structure of guanine is restored. (a) Direct repair of a thymine dimer (b) Direct repair of a methylated base O=