Brock Biology of Microorganisms (15th Edition)
15th Edition
ISBN: 9780134261928
Author: Michael T. Madigan, Kelly S. Bender, Daniel H. Buckley, W. Matthew Sattley, David A. Stahl
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 9.2, Problem 2MQ
Summary Introduction
Before analyzing or after the genome sequence is fragmented, the existing genome must be assembled. The assembly of the genome involves eliminating the overlaps and placing the fragments in the accurate arrangement. The genome assemble must be annotated and it can be helpful in determining the more functional regions and genes. The initial step in the annotation is to identify for the open reading frame (ORFs).
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
What are “forcefields” and how are they used in predicting how a protein sequence will fold?
Using a table that shows which codon represents which amino acid
determine the following:
A) The possible codons that encode Serine:
B) The amino acids that could be encoded if the 2nd position of the UCA codon that encodes Serine was changed to one of the other 3 bases:
C) The amino acids that could be encoded if the 3rd position of the UCA codon that encodes Serine was changed to one of the other 3 bases:
D) The amino acids that could be encoded if the 1st position of the UCA codon that encodes Serine was changed to one of the other 3 bases:
Suppose that there is an unknown protein that underwent Edman sequencing method. From N-
terminal determination, a biochemist found out that there are two N-terminal amino acid residues,
V and G. What is the original sequence of the protein given the following peptide fragments:
after digestion with Chymotrypsin:
G-L-S-R-G-M-w
V-A-L-F
Q-L-Y
L-R-V-W
G-M-V-E-A-D-I-P
K-S-P-E-M-T-W
R-M-A-S-E-K-P-G-H
after digestion with Trypsin:
P-G-H
V-W-G-M-V-E-A-D-I-P
M-A-S-E-K
G-M-W-Q-L-Y-L-R
S-P-E-M-T-W-R
G-L-S-R
V-A-L-F-K
after digestion with Cyanogen Bromide:
T-W-R-M
W-Q-L-Y-L-R-V-W-G-M
V-E-A-D-I-P
A-S-E-K-P-G-H
V-A-L-F-K-S-P-E-M
G-L-S-R-G-M
Chapter 9 Solutions
Brock Biology of Microorganisms (15th Edition)
Ch. 9.1 - How many protein-encoding genes are in the human...Ch. 9.1 - List three examples of how genomics has led to...Ch. 9.1 - What is one discovery resulting from the...Ch. 9.2 - What key molecules are essential for danger...Ch. 9.2 - Prob. 2MQCh. 9.2 - What is the major problem in identifying genes...Ch. 9.2 - How can protein homology assist in genome...Ch. 9.3 - What lifestyle is typical of Bacteria and Archaea...Ch. 9.3 - Prob. 2MQCh. 9.3 - Prob. 3MQ
Ch. 9.3 - Prob. 1CRCh. 9.4 - Prob. 1MQCh. 9.4 - Prob. 2MQCh. 9.4 - Prob. 3MQCh. 9.4 - Which genomes are larger, those of chloroplasts or...Ch. 9.5 - Prob. 1MQCh. 9.5 - Prob. 2MQCh. 9.5 - Prob. 3MQCh. 9.5 - What is the major difference in how duplications...Ch. 9.6 - Which class of genes is rarely transferred...Ch. 9.6 - List the major mechanisms by which horizontal gene...Ch. 9.6 - How might transposons be especially important in...Ch. 9.6 - Explain how horizontally transferred genes can be...Ch. 9.7 - Prob. 1MQCh. 9.7 - Prob. 2MQCh. 9.7 - Prob. 3MQCh. 9.7 - Explain how chromosomal islands might move between...Ch. 9.8 - Prob. 1MQCh. 9.8 - How is a metagenome analyzed?Ch. 9.8 - Prob. 1CRCh. 9.9 - Prob. 1MQCh. 9.9 - Prob. 2MQCh. 9.9 - Prob. 3MQCh. 9.9 - Prob. 1CRCh. 9.10 - Why is the term proteome ambiguous, whereas the...Ch. 9.10 - Prob. 2MQCh. 9.10 - Prob. 3MQCh. 9.10 - Prob. 1CRCh. 9.11 - Prob. 1MQCh. 9.11 - What is a secondary metabolite?Ch. 9.11 - Prob. 1CRCh. 9.12 - How are single cells isolated from a mixed...Ch. 9.12 - Prob. 2MQCh. 9.12 - How can single-cell genomics be used to address...Ch. 9.13 - Prob. 1MQCh. 9.13 - Prob. 2MQCh. 9.13 - Prob. 1CRCh. 9.14 - Prob. 1MQCh. 9.14 - Prob. 2MQCh. 9.14 - Prob. 1CRCh. 9 - Apart from genome size, what factors make complete...Ch. 9 - Describe how one might determine which proteins In...Ch. 9 - The gene encoding the beta subunit of RNA...Ch. 9 - Describe how you could use systems biology to...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- What is the molecular weight of an MRNA that codes for the protein of molecular weight 75000KD? (Assume the molecular weight of an amino acid residue is 120 Da)arrow_forwardWhat is an SMC complex? Describe two examplesarrow_forwardWhat type of bonding interaction causes stem-loops to form?arrow_forward
- What does tRNA stand for?arrow_forwardWhat is a motif? Why is it useful for computer programs to identifyfunctional motifs within amino acid sequences?arrow_forward1.) What do the first four letters represent in the polypeptide sequence of SARS-CoV-2 surface glycoprotein. 2) Draw the structure of the first 4 amino acids in the polypeptide sequence of SARS CoV-2 surface glycoprotein. 3) What amino acid is encoded by the first 3-letter DNA sequence in proteins? Identify and discuss start and stop codons.arrow_forward
- Construct a multiple protein sequence alignment using human HOXD13 and 9 other orthologues of human HOXD13. In the figure legend, describe what is being shown, and specify the size (start and stop number of amino acid) and location of conserved domain(s) in HOXD13 level: UNIarrow_forwardWhat experimentally derived information led to Holley’s proposal of the two-dimensional cloverleaf model of tRNA?arrow_forwardWhat is an anticodon and where is it located on the tRNA structure?arrow_forward
- What are the three major types of RNA molecules? How is eachrelated to the concept of information flow?arrow_forwardConsider the following coding 71 nucleotide DNA template sequence (It does not contain a translational start): 5’- GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3’ By in vitro translating the mRNA, you determined that the translated peptide is 15 amino acids long. What is the expected peptide sequence in single letter abbreviations?arrow_forwardWhat would be the minimum length(approximate number of bases) of an mRNAthat coded for a protein 300 amino acidslong?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Genome Annotation, Sequence Conventions and Reading Frames; Author: Loren Launen;https://www.youtube.com/watch?v=MWvYgGyqVys;License: Standard Youtube License