Q: If a cell is deficient of REC8, how would this affect the chromosome movement during mitosis and…
A: REC8 is a very important component of meiosis specifically the prophase It forms the pro phase…
Q: In guine pigs, rough coat (R) is dominant to smooth coat (r). What is the expected percentage of…
A: ANSWER';- 50% Explain;- A heterozygous guinea pig (Rr) and homozygous passive guinea pig (RR) have a…
Q: 21. During which phase of the cell cycle does DNA synthesis take place? A. Anaphase B. Metaphase C.…
A: A cell cycle is a series of activities that take place within a cell as it grows and divides. The…
Q: 4) Which do you believe has a better impact on health: macronutrients or micronutrients? Explain…
A: NUTRIENTS: The chemical substances required by an organism for its growth, survival, and…
Q: Allan, a 12th grader, had pancit for lunch. Later on, he observed some itchiness and rashes on his…
A: * Allergies are nothing bur your bodys reaction to harmless substance like pollen grains and molds…
Q: What molecules are released by activated helper T cells? Note: This is a multiple question, choose…
A: As they are necessary for practically all adaptive immune responses, helper T cells are perhaps the…
Q: The mouse REST gene is under the control of a promoter region which contains alternative promoters.…
A: Ribosomes perform an important function in protein biosynthesis in the cytoplasm. The mRNAs that are…
Q: Arecaceae or the palm family has a tropicopolitan distribution with some extensions in the…
A:
Q: 3. In radishes, flower color may be red, purple or white. The edible portion of the radish may be…
A:
Q: 15. differntial splicing allows a single gene to produce multiple proteins true or flasev
A: Alternative Splicing or Differential Splicing enables the inclusion or exclusion of particular exons…
Q: Describe the effects of streptococcal haemoysins giving an example of streptococci that can manifest…
A: A "microbe" is a living entity that is so tiny that it cannot be seen with the naked eye.…
Q: formation of different cellular phenotypes is due to the equal distribution of the cytoplasmic…
A: Phenotype shows the appearance of individual. genotypes shows the genetic type.
Q: tight packing of previously less condensed chromatin identify which describes the statement…
A: Post translational modifications in histone proteins can change the shape of chromatin, which can…
Q: female calico cat has patches of black and white due to random x-chromosome inactivation a.…
A: * Calico cats are always femal and they will displays red and black based colors depends on which…
Q: Describe and discuss the concepts of plant growth, development, reproduction, and the basic…
A: All living organisms have the ability to reproduce and grow. Mitosis is the process through which…
Q: oxytocin gene due to methylation. II. Mice with hypermethylation of the agouti gene became obese and…
A: Membrane fracturing, physical or pharmacological opening of the cervix, and oxytocin injection,…
Q: . rat liver mannan-binding protein gene yields two different mRNA sizes 1.4 and 3.5 kb identify…
A: Pre transcriotion contol involved in DNA methylation and chromatin packing . Transcription control…
Q: Q4/ What is Osteoporosis disease? Explain the pharmacist role in giving the suitable prescriptions…
A: Across most vertebrate animals, a bone is a hard organ that is part of the skeleton. Bones protect…
Q: How are concatemers of the Herpes Virus resolved to make sure only a single copy of the genome is in…
A: Herpes virus is very notorious for causing various types of infections which are very hard to treat…
Q: RNAi (or RNA interference) is the process of creating double-stranded RNA in the cells. Explain how…
A: * RNA interference (RNAi) also called as Post Transcriptional Gene Silencing whi h is an conserved…
Q: 5. In corn plants, a dominant allele I inhibits kernel color, while the recessive allele i permits…
A:
Q: WHAT IS Humoral Immunity
A: Active immunity is the immunity induced in entities by the exposure of antigens. It is mediated by…
Q: in m 5'- 3'- Shown below is a schematic diagram illustrating a very short gene with 3000 bp region…
A: Transcription is the process of formation of transcript that is mRNA from DNA. It is catalysed by…
Q: How many μ moles of acetaldehyde are required to allow complete oxidation of the pyruvate to 15µ…
A: the limited supply of NAD+ will deplete the reaction initially causing the reaction to stop, but…
Q: The following truncated sequences are the receptor binding domain of COVID19’s & SARS’ S-protein,…
A: A virus's receptor-binding domain (RBD) is a critical component of the virus's'spike' domain that…
Q: 1. Epigenetic marks established at infancy will persist throughout an individual's lifespan. II.…
A: As a result, vitamins and biologically active components can transiently modify DNA methylation…
Q: Identify what is being described by each of the following statements. Write your best answer on the…
A: Evolutionary studies Evolution is the change in characteristics over time to survive and reproduce…
Q: If you had a template sequence of AACCGTTA, how many flushes of nucleotides would it take to get the…
A: DNA sequencing is a process which encompasses biochemical methods gor determining the order of the…
Q: Hello! What are the two drugs that have potential for treating Alzheimer’s diseases? And compare…
A: Answer :- The two drugs that have potential for treating Alzheimer’s diseases are :- -…
Q: DODO 0 0 Consider the characteristics given on the first column of Table 18. Put a check on the…
A: When researching biological entities, following a predefined hierarchy and order makes it easier to…
Q: Discuss the coevolution of polydnaviruses and their mutualistic partners
A: Introduction Polydnaviruses are insect viruses that belong to the Polydnaviridae family. The family…
Q: In humans, the genes for red-green color blindness (R = normal, r = color blind) and hemophilia A (H…
A: Given: In humans, The genes for red-green color blindness (R = normal, r = color blind) and…
Q: 2.If Peter is allergic to peanuts and Paul is not, what is the precise molecular difference in…
A: 2. If Peter is allergic to peanuts and Paul is not, what is the precise molecular difference in…
Q: In addition to phagocytosis, neutrophils use a process called NETs. Which one of the following…
A: Introduction NETs were first described as a type of innate pathogen defence system that may trap…
Q: cell determination is the expression of the cell's specialized role true or false
A:
Q: In ELISA, what is the importance of washing? When does washing is performed?
A: Introduction :- Enzyme-linked immunoassay (ELISA) is an acronym for enzyme-linked immunoassay.…
Q: Questions 3 and 4 refer to the following diagram. Tertiary Consumer Snake Secondary d Consumer Toad…
A: The strata is very important in various ecological cycles as it keeps the consumers and producer…
Q: 1) RNA polymerase 2) sigma (o) subunit of RNA polymerase 3) rho (p) factor 4) transcription factors…
A: RNA polymerase extend or polymerise RNA. Sigma subunit of RNA polymerase binds to promoter…
Q: . heterochromatic regions decondense for gene expression a. pre-transcriptional control b.…
A: Heterochromatin regions are condensed regions of the chromatin that are transcriptionally switched…
Q: For each protein, identify the following: If the protein is an integral, peripheral, or amphitropic…
A: * Integral monotopic proteins will permanently attached to membrane from one side only then it is…
Q: A massive die-off of lobsters in the Long Island Soundwas blamed on pesticides sprayed to control…
A: Introduction Mosquitoes belong to the Culicidae family, which contains almost 3,600 species of tiny…
Q: Two different species of bacteria are growing together in a mixed biofilm in the intestine of a…
A: Autoinducer-2 (AI-2) is a signal molecule produced by LuxS, an enzyme found in many bacterial…
Q: 13.Why does carbon dioxide need to be transported in the form of bicarbonate ions? (This is multiple…
A: The transport of gases takes place via the blood from the lungs to tissues and vice versa. The O2 is…
Q: enzymes ECORI and HINDIII are called "compatible" enzymes. DNA cut with these enzymes can be ligated…
A: Restriction Endonucleases Restriction endonucleases or restriction enzymes are the enzymes that can…
Q: 9.Statement 1: Major histocompatibility complex proteins help the immune system recognize 'self' vs…
A: Immunity deals with the study of how body's immune system works against foreign pathogens to…
Q: 5. In mice, black color (B) is dominant to white (b). At a different locus, a dominant allele (A)…
A: Phenotype is the physical look of a bodily character. Phenotypic ratio refers to the rate or…
Q: 13. The presence of freckles (F) is dominant to no freckles (f). Jake and his mom have freckles, but…
A: Introduction The term "genotype" refers to an organism's whole complement of genes; in other words,…
Q: DNA replication is fast, virtually error-free, and coordinated with cell division. Discuss which of…
A: DNA replication is fast:- DNA replicates at a rate of 50 nucleotides per second. In both cases,…
Q: Define death in physiological terms. We know that when the human heart stops beating, it can be…
A: The cardiovascular system is a network of arteries and veins in which the heart pumps blood. One of…
Q: Enzyme B requires Zn2+ (Zinc ion) to be functional. Zn2+ is a Cofactor O Product O Coenzyme O…
A: Coenzymes are chemical molecules that are needed for enzymatic performance by numerous enzymes.…
Nucleotides
It is an organic molecule made up of three basic components- a nitrogenous base, phosphate,and pentose sugar. The nucleotides are important for metabolic reactions andthe formation of DNA (deoxyribonucleic acid) and RNA (ribonucleic acid).
Nucleic Acids
Nucleic acids are essential biomolecules present in prokaryotic and eukaryotic cells and viruses. They carry the genetic information for the synthesis of proteins and cellular replication. The nucleic acids are of two types: deoxyribonucleic acid (DNA) and ribonucleic acid (RNA). The structure of all proteins and ultimately every biomolecule and cellular component is a product of information encoded in the sequence of nucleic acids. Parts of a DNA molecule containing the information needed to synthesize a protein or an RNA are genes. Nucleic acids can store and transmit genetic information from one generation to the next, fundamental to any life form.
Step by step
Solved in 2 steps with 1 images
- Given the following codons and their corresponding amino acids: UUU-Phenylalanine GAA- Glutamate CAA- Glutamine AAU- Asparagine AAC- Asn AAA- Lysine UCU- Serine GGA-Glycine ACC-Threonine AUG- Met/ START codon CCU- Proline GUU- Valine UAU-Tyrosine UAA- STOP AGG- Arginine AUU- Isoleucine CAU- Histidine GCU- Alanine UGU-Cysteir GAU-Asparti CUA-Leucine UGG-Tryptol CGU-Arginin Box 1: Show the mRNA sequence which codes for the short peptide, lys-ala-phe- leu. Include what should come before and after this short message. Don't leave any spaces between the letters. Box 2: Show the tRNA anticodon sequence that would line up with the mRNA strand from Box 1. Don't leave any spaces between the letters. Box 3 & 4: Show the DNA base sequence that would be found in the DNA double helix which carries the gene for this peptide. Give the coding strand sequence in Box 3 and template strand sequence in Box 4. Don't leave any spaces between the letters. Box 5: What if there was a frameshift at leucine…Given the genetic code below, enter the correct amino acid sequence for the following RNA sequence: AUG GAG UCC UUG CUG UGA (enter the amino acids as the 3 letter abbreviation on the table separated by dashes with no spaces e.g. Met-Thr-Lys-Glu-Ser) Alanine (Ala) AGUC Tyrosine (Tyr) Valine (Val) GU Cysteine (Cys) START HERE G Arginine (Arg) G Tryptophan (Trp) A C CUGA Serine (Ser) Leucine (Leu) Lysine (Lys) Proline (Pro) Asparagine (Asn) 0406 ACUGACUOROE (na) auone (aug) Giycine (Gly) Serine (Ser) Phenylalanine Glutamic acid (Glu) Aspartic acid (Asp) Histidine (His) Glutamine (Gin) Arginine (Arg) Isoleucine (lle) Methionine (Met) o Threonine (Thr)The sequence of a polypeptide is determined by the order of codons that specify the amino acids in the polypeptide. How many different sequences of codons can specify the polypeptide sequence methionine-histidine-lysine? (Use the table to find the number of possibilities.) SECOND BASE UAU UACFTyrosine (Tyr) UAA -Stop codon UAG -Stop codon UUUL UGU Cysteine (Cys) UCU uc UCA FSerine (Ser) uca Uuc Phenylalanine (Phe) UUAL Leucine (Leu) CAU CAC CAA Glutamine (Gin) CAGF UGA -Stop codon uaa -Tryptophan (Trp) CGU сос CGA FArginine (Arg) CU CU Histidine (His) CuA FLeucine (Leu) Cua) Proline (Pro) CCA cca AAU Asparagine (Asn) AGU Serine (Ser) AGC AUU ACU ACC Threonine (Thr) AACF AAA AAGLysine (Lys) AUC Fisoleucine (lle) AUA Methionine (Met) AUG - Start codon ACA ACG AGA AGGFArginine (Arg) GU GACAspartic acid (Asp) GGA GAA Glutamic acid (Glu) Gaa) GcU -Valine (Val) G GUA GCA FAlanine (Ala) Glycine (Gly) 8. 1 4 THIRD BASE 2. FIRST BASE
- Write the sequence of the mRNA molecule synthesized from a DNA template strand having the sequence 5'-ATTACAGGCGGT-3' 5'- UAAUGUCCGCCA Incorrect Write the amino acid sequence encoded by the mRNA base sequence 5'-GAGUUAGUUUGUAAGUGC-3' Assume the reading frame starts at the 5' end. Refer to the codon table . Amino acid sequence: Glu-Leu-Val-Cys-Lys-Cys What is the sequence of the polypeptide formed on addition of poly(UUAC) to a cell-free protein-synthesizing system that does not require a start codon? Enter an amino acid sequence of four amino acids using the three-letter abbreviations. Polypeptide sequence: Poly( -3' Glu-Leu-Val-Cys-Lys-CysGiven the following DNA sequence: 3'-TACTTNGTNCTNTCN-5' where N stands for any nucleotide, give the complementary mRNA sequence. Indicate direction of strand as 3'--> 5' or 5'--> 3' as in the given sequence above. Give the amino acid sequence of your mRNA sequencelin No. 1. Indicate direction of strand as above. Use all lowercase letters, 3-letter name of amino acid separated by a hyphen (-), no spaces in-between.Part of a sequence of DNA from a person without this genetic disease is: TAG TAA AAA CCA CCC AGG Part of a sequence of DNA from a person with a genetic disease is: TAG TAA CCA CCC AGG The possible codons for some amino acids are shown in the table. Amino acid Codons glycine GGU GGC GGA GGG isoleucine AUU AUC phenylalanine UUU UUC serine UCU UCC UCA UCG Which amino acid is missing from a person with this genetic disease? serine glycine O phenylalanine isoleucine
- The DNA in the coding strand below contains a short imaginary sequence for a short protein in Squibillus notables (imaginary bacterial organism). Indicate the mRNA and amino acid sequences. Label the 5' and 3' ends, the amino (N-terminus) and carboxyl (C-terminus) ends and start/stop codons, if present, as appropriate. 5'- ATGTACCTCGACGATCAAGGCAA -3'If DNA segments changes from GCATAG to GCATA, this is a: MRNA Codon/Amino Acid Chart First Base Second Base Third Base U A G 0001 Phenylalanine UCU UAU1 Tyrosine (Tyr) UAC UGUT FCcysteine (Cys) UGCJ U UUCJ (Phe) UCC Serine (Ser) UCA U UUA1 UAAT UGA - Stop A FLeucine (Leu) UUG- FStop UAG- UCG- UGG - Tryptophan (Trp) G CU- CCU CGUT CAU1 Histidine (His) CAC U CUC FLeucine (Leu) CUA CC Proline (Pro) CCA CGC FArginine (Arg) CGA CAA1 Glutamine A CAGI (Glu) CGG- CUG- CCG- G AUU AAU1 Asparagine ACU1 AGUT FSerine (Ser) AGC- AUC FIsoleucine (le) ACC Threonir AACJ (Asn) A AUA- ACA (Thr) AAA1 FLysine (Lys) AAG- AGA, FArginine (Arg) AGG- A Start Methionine (Met) ACG- AUG - GUU- GCU GAU- GGU | Aspartic Acid GAÇJ(Asp) U GỤC Valine (Val) GUA GCC FAlanine (Ala) GGC Glycine (Gly) GGA G GAA1 Glutamic Acid A GCA GCG- GAGJ (Glu) GGG- GUG- GUse the codon chart to determine the following RNA strand in amino acids (Remember to write it the same way the strand is): ACA-AGG-UUA-UGA second letter C A UAU Tyr U UUU UCU UGU Phe Cys UUC UCC UAC UGC C Ser UAA stop | UGA stop| A UAG stop UGG Trp UUA UCA UUG Le UCG CUU CCU CAU CGU His CUC ССС CAC CGC Leu Pro Arg CUA ССА САА CGA Gln СCG CAG CGG CUG AGU AAU Asn AUU ACU Ser AGC S AGA Arg AAC AUC } lle A AUA АСC Thr AAA Lys АСА AUG Met ACG AAG AGG GUU GCU GAU GGU Asp GAC GGC Gly GGA GCC GUC Val Ala GAA GAG } GUA GCA Glu GGG GUG GCG Your answer first letter ACUCAGUCAGUCAG third letter
- The codon chart below shows that adenine-uracil-guanine (AUG) codes for the amino acid methionine, and cytosine- adenine-guanine (CAG) codes for glutamine in humans. RNA Codon Chart UCAGUGA Alanine Tyrosine Stop Cystoine Stop Valine G U A GTryptophan Arginine A Leucine Serine Lysine Proline Asparagine ACU lGACU Select the two amino acids that those two codons code for in carrots. O glutamine O isoleucine methionine serine O valine oupne Glycine Phenyl- acid Asparti oartic acid Histidine Glutamine Arginine uauonejos Methionine ThreonineUsing the codon table, identify a 5’-3’ sequence of nucleotides in the dna template strand for mRna coding for the polypeptide sequence NH2-PHe-Pro-lys-COOH.On the space provided, type the translation product of wild-type gene A (use three- letter abbreviation for the amino acids; use - to indicate a peptide bond). 5' CTAATCGCCTAATCCGCTTGCGGCCAT 3'