Q: Cellular reprogramming and induced pluripotent stem cells have allowed scientists to model various…
A: pluripotent stem cells have been used in the breeding programs as the stem cells have the capacity…
Q: SET 2: In corn, the following allelic pairs have been identified in chromosome 3: +/b plant color…
A: Introduction An individual expressing a dominant phenotype could have two copies of the dominant…
Q: how can your knowledge of the different locations and drainage of the Lymphatics of the head and…
A: Answer
Q: 1. Why do waterfowls posses an intromittent organ that is highly elaborated? 2. What happens if you…
A: Answer :- 1)Intromittent organ in waterfowl by determining the relationships between intromittent…
Q: Match the subfamilies of HSPGS withe their examples v syndecans and CD44V3 A. Secreted ECM…
A: Match the following. a. Perlecan and collagen XVII ---------------------------------------…
Q: Ma nave 1. requires ATP A. diff 2. random movement of molecules from high to low B. fa 3. molecules…
A: Cell transport is a mechanism that brings about the movement of materials across the cell membrane.…
Q: 1. Substances move through biological membranes against concentration gradients via: a. Simple…
A: *simple osmosis is spontaneous passage of water through a semipermeable membrane * Active…
Q: In all types of bacteria, there are DNA and RNA. * True O False
A: This is true...
Q: Why is it important to wash fruit
A: Washing is a basic hygiene and safety process for the consupmtion of fruits and vegetables. It is…
Q: Discuss the characteristic of DNA polymerase 1, Nick translation Proofreading
A: The heterocatalytic process by which a new DNA stand is synthesized on a old DNA template is known…
Q: Which of the following are two types of bone marrow? a) Red marrow and yellow marrow b) Red marrow…
A: Introduction- Bone marrow is the core of most bones and contains numerous blood veins. Red and…
Q: Q4.1. The image below shows a neuron's response to a medium-intensity stimulus. Which of the options…
A: “Since you have asked multiple questions, we will solve the first question for you. If you want any…
Q: The number of Microorganism A was exposed to a constant temperature of 117 C surviving spores of the…
A: D value is decimal reduction time and is described as time needed at a particular temperature for…
Q: explain also.
A: PABP (Poly A binding protein) is a RNA binding protein which triggers the binding of eukaryotic…
Q: The molecular weight of a particular polymer should fall between 750 and 1,035. Thirty samples of…
A: The quality characteristic has a normal distribution with specification limits USL = 1035 and…
Q: Answer questions in the table below about the shape of the hydrogen cyanide (HCN) molecule. How many…
A: The structure of the HCN is linear as the central atom is carbon .
Q: Cite 4 important Glycobiology applications or studies
A: Glycobiology is the branch of Biology that deals with the study of the structure, function,…
Q: What is special about the coloring of most tinamou eggs? 2. What ability do tinamous have that…
A: 1. The colour of the tinamou's eggs is due to the interplay between pigment coloration and what is…
Q: which type of transmembrane protein binds to insulin and opens a transport proteins allowing glucose…
A: Insulin is an peptide hormone secreted by the beta cells of the pancreas acting through a receptor…
Q: h to get a like.or don't attempt plz.Thanks
A: All the efforts of individuals of a population are directed towards survival of the fittest and if…
Q: Match the following methods of Anlaysis Fractional analysis, methylation, and periodate oxidation A.…
A: Introduction An enzyme is a type of protein found within a cell, these proteins helps to speed up…
Q: You implant a sample material subcutaneously in the back of a rabbit model in an effort to evaluate…
A: Injury, blood material interactions, provisional matrix construction, acute and chronic…
Q: What is the importance of mitosis for the embryonic development?
A: Introduction - The development and creation of the human embryo is known as human embryonic…
Q: What are 7 herbivores organisms
A: Herbivores, are those animals that are anatomically and physiologically adapted to eating plant…
Q: Why does the genus Streptomyces of the Actinobacteria clade secrete chemicals (antibiotics) that can…
A: Streptomyces is the largest genus of the Actinomycetota and the type genus of the family…
Q: If you examined an en-GFP transgenic fly, where would you expect to see GFP expression? O In the…
A: *GFP can be introduced to animals by using transgenic techniques will be maintained in their genome…
Q: anaerobic fates of pyruvate (conversion to lactate or ethanol) in terms of ATP production?
A:
Q: 31. Part of normal microbiota. Causes serious pulmonary disease A. Bordetella pertussis In…
A: Respiratory diseases are one of the most common diseases suffered at any age. The reason partly…
Q: Is the DNA of our father identical with the DNA in our mother?
A: ANSWER;- NO, the DNA of our father is identical to the DNA of our mother.
Q: For each of the following sentences, choose one of the options enclosed in square brackets to make a…
A: * Meiosis is a type of cell division in which sexually-l reproducing organisms used to produce the…
Q: The adaptive response is a robust and critical component of the immune systemis able to combat…
A: The immune system It is a group of cells, substances, and processes that help protect the skin,…
Q: Q4.3. After the rising phase, which ion channel is responsible for action potential returning to its…
A: Introduction An action potential is a rapid rise or an explosion of electrical activity and…
Q: Question 8 Why is replication called semi-conservative? A not all leading strands are conserved B…
A: During DNA duplication, is the method to copy DNA stands when new cells are formed.
Q: True or false and why.According to the Labeled Line Principle, a receptor such as the nociceptor…
A: The labelled line principle is a theory that explains how various nerves can produce different…
Q: How do cytokine barrier provide inmate immunity in humans ?
A: The human immune system is divided into two main branches, namely the body's first defense…
Q: Which of the following is the vestigial bony part of the human skeleton? a) Cervical b) Cranium c)…
A: Introduction - The interior framework of the human body is called the skeleton. It has roughly 270…
Q: Marcus is admitted to the hospital for a bone marrow stem cell transplant from his brother, What…
A: Introduction They are of various types of stem cells.Embryonic stem cells - They are isolated from…
Q: 1. The alternate form of a gene is A. Alternate type B. Recessive character C Dominant character D.…
A: Answer 1) alternate form of gene is : d) alleles answer 2) if cytosine is 37% then % of guanine…
Q: born with sickle cell anemia. What is the frequency of individuals in this population who do not…
A:
Q: Stainable living strategies for people living in the Savanna Desert in Amboseli National Park…
A: Sustainable strategies are those strategies which are plant in a way to protect the environment not…
Q: using, 3’ TGAGGCGCTAGGCCAAGCGGTAAGGATGCATGGTCGTGGTAG , What would be the resultant type of error…
A: The given sequence is 3'TGAGGCGCTAGGCCAAGCGGTAAGGATGCATGGTCGTGGTAG5' The mRNA sequence will be…
Q: Narcolepsy is thought to occur from dysfunction of neurons located in the hypothalamus hippocampus…
A: Introduction - Narcolepsy is a persistent sleep condition marked by excessive daytime sleepiness and…
Q: A person of type A blood receives blood after a collision between a car and a bus. Shortly after,…
A: Blood transfusion is a process of transferring the same type of blood from the donor to the…
Q: Which of the stated relationships is correct? A. the heart is inferior to the clavicle B. the…
A: A large part of beginning of study of anatomy and physiology is the learning of specialised terms…
Q: A strictly fermentative bacterium produces ATP A. by glycolysis only. B. by photosynthesis only. O…
A: Answer C is correct.
Q: Enzymes that acetylate the e-amino group of lysine in the histone tails are called and are involved…
A: Histone is made up of majority lysine and arginine (positive amino acids) as a result negative…
Q: what to do when you have a stop codon while designing SGRNA for Crispr? I have design SGRNA but it…
A: CDS is a sequence of nucleotides that corresponds with the sequence of amino acids in a protein. A…
Q: true or false: meiosis takes place in body cells called somatic cells.
A: Meiosis is a double division which occurs in a diploid cell and gives rise to four haploid cells…
Q: Calculate the coliform concentration in a milk sample based on the following colony counts: 10 2 :…
A: Introduction Coliform bacteria are defined as rod-shaped Gram-negative non-spore forming and motile…
Q: Cellular reprogramming and induced pluripotent stem cells have allowed scientists to model various…
A: Pluripotent stem cells are the cells which can be developed into any type of the cell in the body .
Describe "bioprospecting" in terms of its environmental inputs. The diagram below can serve as a guide.
Step by step
Solved in 2 steps
- What are the different controversies associated with biotechnological research and its resulting products. Be sure to provide details on exactly why the development is controversial.NEED A HELP WITH THIS QUESTION FOR BIOA biotech company and/or field is often classified as red, green, and white. Investigate what each means and compare them with respect to market size, major products and/or services.