Q: Dolphins have 44 chromosomes. How many chromatids are there in the following cells and/
A: Introduction: The series of activities that a cell goes through as it develops and splits into two…
Q: A prenatal multivitamin supplement is more likely to restrict the amount of which vitamin? Niacin…
A: Vitamins and minerals are essential nutrients that the body needs to function properly. Vitamins are…
Q: What should be the first step in the protocol for the purification of DNA from any source (including…
A: DNA is a nucleic acid found in the nucleus of the eukaryotic cells. It acts as genetic material. DNA…
Q: In a population of yellow mushrooms, a mutation resulted in a new purple type of mushroom that…
A: Introduction :- Non-random mating occurs when individuals in a population choose mates based on…
Q: Briefly describe the contributions of Carl Linneaus, C. Woese, and Bergy to the classification of…
A: When organisms are kept in a particular group and subgroup on the basis of their similar…
Q: Select a biotechnology approach and describe why this is a good idea, or why it is not a good idea.…
A: Introduction Biotechnology is the application of biological processes, organisms, or systems to…
Q: The diagram shows which level of structure of a protein? hydrogen- bond HO-C HO ,0 CH₂ ionic bond-…
A: Proteins are complex macromolecules that perform a wide range of functions in living organisms. The…
Q: Origins of replication, centromeres, and telomeres are all involved in replication and segregation…
A:
Q: 4. Using the bicarbonate buffer system as an example, explain how buffers work
A: Buffer is a solution usually made up of weak acid and its conjugate base or a weak base and its…
Q: Notice that when comparing our amino acid sequence to a fruit fly, we have a difference of 29 amino…
A: Various techniques have been used to study the evolutionary relationships among organisms, amino…
Q: Take a picture of each stage and place it in the appropriate circle in your diagram. Example:
A: Mitosis: The process of cell division where the parent cell undergoes cell division to produce two…
Q: Provide the major organelles involved in protein synthesis and packaging.
A: Protein synthesis involves four different organelles. These comprise the ribosomes, rough…
Q: Would you expect an instrinsically disordered protein to contain a higher proportion of hydrophilic…
A: A protein is a macromolecule made up of one or more chains of amino acids. Proteins are essential…
Q: Describe what biomarkers are used by electrochemical immunosensors to treat tumor cancers
A: Electrochemical immunosensors are easy-to- use, quick, trustworthy, and affordable tools with…
Q: 3.Explain how acids and bases directly or indirectly affect the hydrogen ion concentration of a…
A: Acids and bases directly and indirectly affect the hydrogen ion concentration of a solution by…
Q: 1. Draw a chromosome and a pair of homologs (or homolog pairs, or homologous chromosomes). Label on…
A: Introduction Homologous chromosomes are pairs of chromosomes that have the same structure, gene…
Q: When hydrogen covalently bonds to carbon it creates a nonpolar bond. However, when hydrogen…
A: Hydrogen bonds form between a hydrogen atom that is covalently bonded to an electronegative atom…
Q: QUESTION 1 Sodium fluoride (NaF) is a O a. cell nutrient O b. cellular poison O c. type of yeast O…
A: Introduction :- Sodium fluoride (NaF) is a type of salt that is commonly used in small amounts as a…
Q: Label the parts of the digestive system?
A: DIGESTIVE SYSTEM Human digestive system starts from the mouth and ends with the anus. Digestive…
Q: our sister breeds Labradors, but is unaware of the genetics of coat color, so she has been mixing…
A: Introduction :- Genes are the basic units of inheritance that carry instructions for the development…
Q: Silky feathers in fowls are caused by an allele which is recessive to the allele for normal…
A: Let the dominant allele in this case be F and recessive allele be f. So two heterozygous individuals…
Q: hat the Na+ concentration i Transport of two Na+ ions in f the Nat concentration out
A: Introduction: To calculate the maximum energy available for pumping a mole of glucose into the cell,…
Q: How are fats digested mobilized and transported inside the body in the fed and fasted states
A: INTRODUCTION Fats are one of the three macronutrients found in the human diet, alongside…
Q: Match each molecule with the corresponding description. Answer choices may be used only once.…
A: Introduction Macromolecules are large, complex molecules that are essential for life. They are…
Q: What are nucleic acids composed of? a) fatty acids ○ b) amino acids c) glucose d) nucleotides
A: Natural chemical substances called nucleic acids seem to be the main information-transporting…
Q: Which one kills microbes by altering and oxidizing proteins and membranes? a.Ag…
A: The options given in the question are either antiseptic or disinfectant. Disinfectants are used to…
Q: Phospholipids contain a glycerol backbone attached to two fatty acid hydrocarbon tails (often 18-20…
A: A large group of biomolecules known as lipids includes fats, oils, waxes, phospholipids, and…
Q: n dogs, the trait for coat color influences the trait for short legs. Black coat (B) is dominant to…
A: Introduction: Genetic inheritance is the process by which genetic information is passed from one…
Q: Patterns in Nature: Why is the spiral important in snail shells?
A: Snail is a shelled gastropod having soft body and no legs Scientific classification of snail --…
Q: Explain why is it important to follow proper precautions
A: Introduction: Aseptic refers to conditions or practices that are free from harmful microorganisms,…
Q: Competitive inhibition is where an enzymatic reaction is regulated by the product of the reaction.…
A: Proteins called enzymes assist human bodies' chemical processes move forward more quickly. For…
Q: Darwin was the first and only person to propose evolution True False
A: Introduction : Natural selection was the foundation upon which Charles Darwin constructed his…
Q: ------------ of finch populations on the Galapagos Islands allowed species to evolve on each…
A: Introduction :- A species is a group of living organisms that are similar to one another and can…
Q: Hexokinase/ glucokinase, Phosphofructokinase( PFK), Pyruvate Kinase What is the purpose for each of…
A: Introduction Cellular respiration is the process by which cells convert glucose and oxygen into…
Q: Protein A is a transmembrane protein in the plasma membrane. Its N-terminus is on the cytoplasm side…
A: Introduction Transmembrane proteins are proteins that span the lipid bilayer of a cell membrane and…
Q: To what energy budget item is an excess or shortfall in intake credited or debited? (More than one…
A: Energy balance is a crucial aspect of human physiology that refers to the balance between energy…
Q: Why is The
A: Introduction: The World Anti-Doping Code (Code) is a document that sets out the rules and principles…
Q: CO-DOMINANCE/I... 2/3 | All 1 87% + 3. A homozygous red gummy bear is crossed with a homozygous…
A: Introduction :- A Punnett Square is a tool used to predict the offspring of a genetic cross between…
Q: Which is not a factor that leads to the extinction of a species?
A: Introduction A species being extinct means it will never return to the planet. It occurs when the…
Q: What do you know about each of the four greenhouse gases seen in the graph above? The major…
A: "The major contributor of CO2 is the combustion of fossil fuel": Partially correct; combustion of…
Q: Which of these are pyrimidines? O a) thymine, adenine, and cytosine O b) adenine and guanine c)…
A: Pyrimidines Pyrimidines are one of the two types of nitrogenous bases found in DNA and RNA…
Q: Relate the chemical structure of phospholipids to their physical properties and uses. Use a diagram…
A: Phospholipids are esters comprising two fatty acid molecules joined to a glycerol molecule and a…
Q: 5’ GGACCTATCAAAATCCTTATGCGCTAGGATAGCTAACGCATCCAC3’ This is the template strand. The +1 transcription…
A: Introduction : One of the earliest steps in gene expression is transcription. The transfer of…
Q: Which organism are we most distantly related to and why do you think so?
A: The evolutionary relationship means the two or more species which share the common ancestors. The…
Q: What are the properties of water? Select all that apply. high boiling point low solid density…
A: Water(H2O)is an essential chemical substance. It is a colorless, tasteless, odorless, and nearly…
Q: Sickle cell anemia causes hemoglobin, the oxygen - carrying molecule of red blood cells, to be…
A: Sickle Cell anaemia is inherited in an autosomal recessive pattern , which means both copies of the…
Q: || || || Multiple Choice: 1. In which organ does peristalsis always vary in speed and force? a.…
A: Peristalsis is a rhythmic contractile movement of the muscles in the wall of a hollow organ that…
Q: In mammals, the developing fetus obtains O₂ from its mother's blood via the placenta. For this to
A: The primary oxygen carrier protein in the developing human is called foetal haemoglobin, also known…
Q: Explain why vector-borne pathogens are difficult to control.
A: Introduction: The term "vector" refers to a live carrier, such as a bug, that carries infectious…
Q: When talking about systems, how dependent must they be on one another, and what does it entail,…
A: Introduction :- The body systems must be highly dependent on one another because they all play a…
Explain the principle behind the streak plate method.
Step by step
Solved in 2 steps
- Describe how the streak-plate method is used to obtain a pure culture and how the resulting culture can be stored.Why is it necessary to cut thin sections of the tissue sample from a specimen using a microtome?What are the advantages and disadvantages of using the Wet Mount technique? What are the advantages and disadvantages of using the Hanging drop technique? What are the advantages and disadvantages of using the Slide Culture technique? pls elaborate each, thank you