How does position effect influence gene expression?1 |The movement of the genetic material on the chromosome by inversions or translocationsmay place a coding sequence near a new regulatory region, thus activating the expression ofthe gene.The movement of the gene may place it into a region that is highly condensed(heterochromatin).The movement of a gene may remove it from its normal promoter, thus silencing the gene.O All of the above answers are correct

ANSWER : The correct option is: All of the above answers are correct

How does position effect influence gene expression? TI The movement y! CDC The movement of the genetic material on the chromosome by inversions or translocations may place a coding sequence near a new regulatory region, thus activating the expression of the gene.

How does position effect influence gene expression? TI The movement y! CDC The movement of the genetic material on the chromosome by inversions or translocations may place a coding sequence near a new regulatory region, thus activating the expression of the gene.

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter16: Regulation Of Gene Expression

Section: Chapter Questions

Problem 5TYK

See similar textbooks

Similar questions

I. The retinoic acid receptor (RAR) is a transcription factor that is similar to steroid hormone receptors. Thesubstance (ligand) that binds to this receptor is retinoicacid. One of the genes whose transcription is activatedby retinoic acid binding to the receptor is myoD. Thediagram that follows shows a schematic view of theRAR proteins produced by genes into which one oftwo different 12-base double-stranded oligonucleotides had been inserted in the ORF. The insertion site(a–m) associated with each mutant protein is indicatedwith the appropriate letter on the polypeptide map.For constructs encoding proteins a–e, oligonucleotide 1(5′ TTAATTAATTAA 3′ read off either strand) wasinserted into the RAR gene. For constructs encoding proteins f–m, oligonucleotide 2 (5′ CCGGCCGGCCGG 3′)was inserted into the gene.NH2 f g h i j k l m COOHa b c d eThe wild-type RAR protein can both bind DNA and activate transcription weakly in the absence of retinoic acid(RA) and strongly in RA’s presence. Each…
4e. You also study the expression of 3 different mutants for this gene. For each mutant answer the following: Does this mutation change the sequence of the protein produced? Why or why not? If it does change the sequence of protein be sure to write out the new sequence. If it does not change the protein sequence, what effect (if any) would you expect it to have on expression of the gene? 1 20 ORI 40 60 5'...TTCGAGCTCTCGTCGTCGAGATACGCGATGATATTACTGGTAATATGGGGATGCACTATC...3' 3' ...AAGCTCGAGAGCAGCAGCTCTATGCGCTACTATAATGACCATTATACCCCTACGTGATAG...5' * promoter
4e. You also study the expression of 3 different mutants for this gene. For each mutant answer the following: Does this mutation change the sequence of the protein produced? Why or why not? If it does change the sequence of protein be sure to write out the new sequence. If it does not change the protein sequence, what effect (if any) would you expect it to have on expression of the gene? 1 20 ORI 40 60 5..ТТCGAGCTСТСGТCGTCGAGATACGCGATGATATTACTGGTААТАТGGGGATGCАСТАТС..3' 3'...AAGCTCGAGAGCAGCAGCTCTАTGCGСТАСТАТААТGACCATTATAССССТАСGTGATAG..5' * promoter i. Mutant A has a single base pair substitution with the T/A being replaced with C/G base pair at position 35 (position denoted by the * in the sequence above). ii. Mutant B has a 2 G/C pairs inserted between position 19 and 20 (position denoted by the ^ in the sequence above).
1. Histone methylation can have many different effects on gene expression. In some cases, histone methylation is associated with activation of transcription, whereas in other cases it can trigger the formation of heterochromatin and a decrease in transcription. If histone methylation has been detected in the region of gene YFG in yeast, describe an experiment that could distinguish whether the methylation is important to activate or repress transcription of gene YFG. al 6 2. An E. coli strain of chromosomal genotype lacl* lacP" lacO* lacz* lacY*. You wish to transform this strain into a wild-type lac operon by the addition of an extra piece of DNA (plasmid). a. What regulatory region(s), gene or genes would you add on this extra DNA that would make this strain express the lac operon genes as wild type? b. How would you design this plasmid if you want the strain of E. coli to express the lac operon genes even if lactose is absent in the medium (constitutively)?
Gene expression is... O How genes are replicated into two new strands identical to each other O How genes are duplicated, forming a new gene O How genes are mutated, creating a new allele O How genes are transcribed and translated into protein
IPSCs are nearly identical to human embryonic stem cells in terms of gene expression, but there may be other ways in which they are not equivalent. For example, the telomeres of IPSCs often vary in length, with many IPSCs cells having telomeres shorter than those of embryonic. How might shortened telomeres affect the life-span of IPSCs or of differentiated cells derived from them?
A scientist compares the promoter regions of two genes. Gene A’s core promoter plus proximal promoter elements encompasses 70bp. Gene B’s core promoter plus proximal promoter elements encompasses 250bp. Which of the scientist’s hypotheses is most likely to be correct? More transcripts will be made from Gene B Transcription of Gene A involves fewer transcription factors Enhancers control Gene B’s transcription Transcription of Gene A is more controlled than transcription of Gene B.
1. Draw a simplified model of a cis-regulatory element with multiple trans-acting factors up-regulating gene expression. Your simplified model must include: a double-stranded DNA molecule labeled with its appropriate orientation (3' and 5', etc.), an area of DNA highlighting the gene of interest to be transcribed, a highlighted area showing the promoter region, one cis-regulatory element upstream of the promoter with its specific transcription factor • RNApol + a general transcription factor + a TATA binding protein all bound to the appropriate area (think about where these bind before transcription starts), an upstream enhancer with its transcription factor bound to it, • and finally the TSS. All parts must be labeled and in the correct area to earn full credit. **I suggest using different colors for this drawing problem**.
4. Which or which (can select more than one alternative) of the control methods of genetic expression in eukaryotes NOT USED in prokaryotic cells?to. control how often a gene is expressedb. control how an mRNA is processedc. control which mRNA is exported from the nucleus to the cytosold. control which mRNA is translated to proteins in the ribosomeand. control how quickly proteins are destroyed once synthesized 5. Unlike DNA that usually forms a helical structure, different RNA molecules assume bends in a wide variety of 3D shapes. This is due to :to. RNA contains uracil and ribose as sugarb. the bases in the RNA cannot form hydrogen bonds with each otherc. nucleotides in RNA have a different chemical structure than they have in DNAd. Although RNA is single-stranded, complementary bases can pair with each other. 6. Viruses consist of a layer of protein that surrounds your genetic material. the genetic material in the HIV virus is:to. Double-stranded DNA (dsDNA)b. Single-stranded DNA…
Dystrophin gene structe 3 T Elijah's X G G Promoter Exon 19 Exon 52 Intron Exon 53 T G Liam's X affected T C СА Difference #3: (gln) Elijah's MRNA UAA (STOP) Liam's MRNA Q5: When DNA polymerase reaches the nucleotides encoding the premature stop codon it will... A. stop when it reaches the first nucleotide encoding the premature stop codon. B. stop when it reaches the last nucleotide encoding the premature stop codon. not be affected by this base change and will continue to read through the nucleotide difference. 26
6. Similar to the class notes (Intro to Genetics), a segment of DNA (shown below) contains a promoter segment (the first 9 base pairs), a ribosome binding segment (the next 6 base pairs), and a segment that codes for protein synthesis which is started by the rest of the base pairs. ACTCCATTGAACCATTTCTATGATCCGCTAACG-... TGAGGTAACTTGGTAAAGATACTAGGCGATTGC-... A. When the DNA is induced to be copied to mRNA, the top strand is coding, meaning that the mRNA makes an identical copy of the lower strand (replacing T with U) The mRNA copy starts with the ribosome binding sequence. What is the sequence of the mRNA that will go to the ribosomes? B. What are the first 6 amino acids of the protein that are coded for by the mRNA? C. What would the amino acid sequence be if... i. a transition mutation occurred on the final G in the mRNA? ii. all of the G & C bases in the protein synthesis portion had transition mutations? iii. a point deletion mutation occurred in the ATA sequence (in the lower strand…
2. Which ONE of these statements on chromatin modification is UNTRUE? O DNA is methylated on the cytosine of CpG sequences in the DNA O Histone acetyl transferases transfer an acetyl group to lysines in histones O Bromodomain proteins bind to acetylated histones O Histone lysine methyltransferases (KMTS) are epigenetic erasers O Epigenetic changes can contribute to cancer evolution NE