Primer pairs of homo sapiens isolate breast cancer brca1 gene. Select the best primer pair then give 5 reasons why is it the best
Q: Production of a recombinant protein by E. coli is proportional to cell growth. Ammonia is used as a…
A: Recombinant proteins are proteins that are produced through genetic engineering. They are created by…
Q: 1. outline the principles and procedures of isoelectric focusing. 2. Explain the four levels of…
A: As per the central dogma of molecular biology, DNA contains the code that is necessary for the…
Q: Standard redox potentials E' for some common compounds in biochemistry: Eo' (Volt) + 0,81 12 O2 + 2…
A: If the Gibbs free is negative for a reaction then the process is said to be spontaneous. A positive…
Q: A carboxypeptidase is a metalloenyme (its active site contains one or more metal ions essential for…
A: An active site of an enzyme is a three dimensional structure that occurs within the enzyme. An…
Q: In the traditional alkaline lysis method, what is the purpose of Solution 1? For what is its use?
A: In the traditional alkaline lysis method for plasmid DNA isolation, Solution 1 (also called…
Q: A cyanobacterium absorbs 2856 photons. How many molecules of ATP are produced?
A: The process of ATP synthesis in cyanobacteria occurs through the process of photosynthesis,…
Q: what is the purpose of staggering the start and stop of the reactions? With reference to your…
A: Chemical reaction optimization is the process of using various techniques to improve the efficiency,…
Q: That is the lactase assay Calculate initial rate
A: Lactase assay is sensitive enzymatic method to estimate the lactose in low-lactose or lactose-free…
Q: You will be given 1 mL of a 2.0 mg/mL solution of bovine serum albumin (BSA) and 1 mL of a 2.0 mg/mL…
A: Dilution in biochemistry is used to lowered and get the desired concentration of solute solution by…
Q: - Draw the graph A340 = f(t). Comment the shape of the curve Calculate alanine, LDH, NADH and…
A: If a particular reaction brings about a measurable change (like the generation or consumption of a…
Q: What is test for carbohydrates and why is it important?
A: Introduction. There are four different types of biomolecules present in our body, carbohydrate,…
Q: Draw your own PCR diagram to show the role of each component and relevance of each temperature shift…
A: The polymerase chain reaction or PCR is a method widely used to rapidly make multiple copies of a…
Q: The 4 graphs above represent the change in enzyme kinetics with the individual addition of different…
A: Enzymes kinetics - is the study of the reaction rate of enzyme catalyzed reactions. The reaction…
Q: How is the PDHC regulated?
A: PDHC refers to pyruvate dehydrogenase complex. Its regulation ensures that the rate of pyruvate…
Q: At what points in the entire process of aerobic respiration is ATP generated?
A: ATP (adenosine triphosphate) is a molecule that serves as the primary energy currency of cells. It…
Q: EcoRI recognizes G A-A-T-T-C sequence and cleave/ cut between G and A. How will the DNA fragments…
A: A restriction site or recognition site, is a specific sequence of nucleotides in DNA that a…
Q: Create a mind map for amino acids.
A: Amino acids - are building blocks of proteins and alpha carbon of amino acids contains amine group,…
Q: 13. In the last step of the absorption-elution method only type B cells cause an agglutination…
A: 13. If only type B cells caused an agglutination reaction in the last step of the absorption-elution…
Q: identify ways in which you could increase the accuracy of the experiment so you could determine with…
A: Performing an experiment requires following ethical and practical guidilines. In a good lab…
Q: Connect the optimum ph each emzine to their location in the body
A: Enzymes are biological catalysts that catalyse biochemical reactions. An enzyme's activity refers…
Q: Why do we make the differences between large carbohydrates, proteins, and nucleic acids?
A: Carbohydrates, proteins, and nucleic acids are macromolecules present in living organisms.…
Q: In chickens, the the B/b locus controls black vs. white feather color (black is dominant). The R/r…
A: We can use Punnett squares to determine the possible genotypes of Hermes and Muffin and then use…
Q: If Vmax for a reaction is 10 μM ⋅ s-1 and the KM is 0.5 μM, what is the reaction velocity when the…
A: Enzyme reaction at different substrate concentration can be characterize by Michaelis Menten…
Q: The kinetics of an enzyme were measured as a function of substrate concentration in the presence or…
A: In a enzyme catalyzed reaction, the data can be plotted in a Lineweaver Burk plot. This plot is also…
Q: Flory-Huggins Theory. How are polymers modeled in the theory, and what does the theory predict? What…
A: Polymers are high molecular-weight compounds made up of smaller molecules linked in a chain-like…
Q: What is the pH of a buffer solution that is .24M NH3 and 2M NH4CI? The acid dissociation constant is…
A: The pH of a buffer solution can be calculated using the Henderson-Hasselbalch equation, which is…
Q: Are natural compounds such as cellulose and petroleum oil easier for microorganisms (eg. bacteria…
A: Microorganisms, such as bacteria, fungus, and algae, degrade and change organic compounds into…
Q: Lysozyme is an enzyme that hydrolyzes bacterial cell wall…
A: Lysozymes are antibacterial agents that have the ability to hydrolyze the cell wall of bacteria. The…
Q: For the PDHC, generally what goes on in each active site, what is the role of lipoamide, and what…
A: The PDHC is an enzyme complex that undertakes the oxidative decarboxylation of pyruvate (i.e. both…
Q: In humans, the biosynthesis of L-glutamine is catalyzed by the L-glutamine synthetase. The global…
A: A negative ∆G value for a reaction implies that the reactants, or initial state, have more free…
Q: Under normal conditions, the human adrenal medulla secretes epinephrine (C₂H₁NO3) at a rate…
A: Concentration of epinephrine is given in molarity (M). Concentration = 10-10 M =10-10 molesliter…
Q: What are the general concepts of microbial metabolism and explain each concepts? (Give at least 4…
A: Microorganisms are microscopic-sized organisms that may exist in the single-celled form or in a…
Q: Phenylketonuria. Clinical manifestations of pathology. Congenital enzyme defect.
A: Amino acids can be degraded & certain amino acid can be interconverted to another amino acid…
Q: 2. In one paragraph, refute or support the statement: "Photosynthesis and oxidative phosphorylation…
A: There are a lot of metabolic processes that essential serve the opposite purposes of each other.…
Q: Acetyl-CoA carboxylase is the principal regulation point in the biosynthesis of fatty acids. Some of…
A: Acetyl-CoA carboxylase (EC 6.4.1.2) is a biotin-dependent enzyme. It is responsible for the…
Q: A cytosolic protein has an important alpha amino group. The pKa of this group is approximately 8…
A: The pKa of an amino acid tells the pH at which both protonated and deprotonated forms of the amino…
Q: Calculate the pI of the following peptides: a. MASTERY b. STICKY c. DALLAS d. ART
A: the isoelectric point of a protein is the pH at which the net electric charge of that amino acid is…
Q: Define enzyme inhibition. Explain in detail the different types of inhibitions with suitable…
A: Introduction Enzyme inhibition refers to the process by which the activity of an enzyme is reduced…
Q: Ammonia detoxification mechanism
A: Ammonia detoxification is the process by which ammonia (NH3) which is toxic to the cells is…
Q: The Neanderthal nuclear genome: A. Shows that Neanderthals inherited their ability to flake stone…
A: Homo neanderthalensis, or Neanderthal man, is an extinct human species that inhabited Europe and…
Q: The active site residues in some proteins seem to be "ultimately conserved," meaning that any change…
A: 2 evolutionary distant organisms, like a fungi and a human could still share a common gene between…
Q: What would be the molecular sequence of the amino acid chain asp-leu-leu? (i.e. draw the whole…
A: amino acids are building blocks of proteins, Alpha carbon of amino acids contains amino group,…
Q: Table 9.2 shows that DGo’ for the aldolase reaction is large, and positive, yet the reaction…
A: The aldolase reaction is a reversible reaction that occurs in the second stage of glycolysis,…
Q: Chitin is a storage form of fuel in plant cells is the storage form of glucose in animals provides…
A: Biomolecules are molecules found in living organisms that play a role in their chemistry. They are…
Q: Which of the following is NOT considered to be a scientific publication?* Evidence based opinion…
A: Publication is the process of preparing and communicating the research findings to the scientific…
Q: please provide an example to solve for Velocity using the Michaelis-Menten Equation
A: Michaelis-Menten Equation is the relation between substrate concentration and velocity of reaction.…
Q: 3. Listed below are four redox couples. An organotroph uses compounds from two of these to carry out…
A: Oxidation and reduction reactions occur in synchrony within the cells. The Oxidation of one…
Q: For items 16-20, determine the monosaccharide units for each carbohydrate. Chc are: A…
A: Chemically carbohydrates are polyhydroxy aldehydes or ketones. They have the general formula :…
Q: Determine a molecular cause that allows explaining the BIOCHEMICAL alterations found in the…
A: a total cholesterol level of less than 200 mg/dL (5.2 mmol/L) is considered desirable and associated…
Q: Given the amino acid chain below, get the (a) translation strand, (b) transcription strand strand,…
A: DNA is double stranded. There one strand is the template strand and the other is non-template. From…
Step by step
Solved in 4 steps
- a) what si the nucleotide at the 5 prime end of the picture? b) what si the DNA sequence from 5 prime to 3 prime pls help, urgently required, no explanation neededWhich of the following would be the correct Haworth projection of a-D-Talose (linear form is in the left side)? * CHO CH,OH CHOH OH HO HO -H- он OH OH HO OH OH OH OH C. CH,OH CH,OH H- он он OH OH CHOH OH OH он O D61 identify the primer 3' 5' a 5' 3' C e f a 5' 3' 3' 5' Select an answer and submit. For keyboard navigation, use the up/down arrow keys to select an answer. a a b b e f a Save Unanswered
- Aa Po AaBbCcDc AaBbCcDdEe AaBbCcDdE AaBbCcDdE AaBbCcDdE BIUVab x, x A ev A 三==|這、|の Caption Emphasis Heading 1 Heading 3 Heading 4 Style Pane (a) Complete the table, using a letter D, R or B, to show whether each statement applies to: Fo DNA only (D) TA2G – Completed forms must be available for Open Awards external moderation purposes. Page 6 of 15 > T | RNA only (R) Both DNA and RNA (B) Statement D or R or B Contains thymine Contains ribose Consists of two chains connected to each other with hydrogen bonds Has a sugar-phosphate backbone Has four different nitrogenous bases Contains a pentose sugar Is found in the nucleus and cytoplasm English (United Kingdom) Focus 目民 2490 words +1Which forward are reverse primers will amplify the following sequence by PCR? 5' GACCTCGCCGACGCCCTCGACCAGCTCCTGCGCCGCACCCGCCACCTCGCCGAGACC GAGCAGAAAACCCGCCGTCGGAGAGCCACCCGCTCCGGTACGGCAGCACAGTTGCCCGA TCTTCCAGGCCAGCGGCGCCCATTCGACGCAGAGACCGCACCGGCCCCGGCACCGGACT GGAGCGAGAGCCTGGACGACCTCATCAGCGTCGACACGGCGGCCCAGACCGGCACGAGC GAGATGGAGGGCGCGAGCGTGCCGCCGGCCGAGGCAGGCGGGTACGGGCTGTGGGACGC CGAAGCGGAAGCCGAGCAATGGTGAACGCCTCACCGGGCACGAGCGATACGCCGGG 3'For each term in the left column, select the term which best matches. 1. deoxyribonucleotide 2. nitrogenous base thymine + deoxyribose 3. deoxynitronucleoside guanine + deoxyribose + phosphate group 4. polydeoxyribonucleotide DNA 5. deoxyribonucleoside 6. nitrogenous base
- Helicase is wrongA Sanger product of the sequencing of a template DNA is presented +ddTTP +ddATP +ddCTP +ddGTP Mononucleotide Pentanucleotide Trinucleotide Dinucleotide 11-nucleotide Hexanucleotide Octanucleotide Tetranucleotide 16-nucleotide Decanucleotide Nonanucleotide Heptanucleotide 17-nucleotide 15-nucleotide 13-nucleotide 12-nucleotide 18-nucleotide 20-nucleotide 14-nucleotide 19-nucleotide 21-nucleotide 1. Determine the sequence of template DNA 2. Determine the mRNA sequence from this template DNA 3. Determine the the sequence of protein product derived from that DNAA DNA strand was sequenced using the Sanger method (https://www.youtube.com/watch?v=KTstRrDTmWI). The reaction tube contained the DNA strand, fluorescently labelled dideoxynucleotide triphosphates (ddATP – yellow, ddGTP – green, ddCTP – blue, ddTTP - red), deoxynucleotide triphosphates, DNA polymerase, or its Klenow fragment. Synthesis of DNA is allowed to proceed, and the results are shown on the right: 15 14 13 12 11 10 (a) What is the sequence of the copy and the template strands? (b) If the template strand were in the 5'-3' direction, what will be the sequence of the DNA copy? Nucleotide Length