you perform a cross of two heterozygous, red-eyed flies. They have 100 offspring. How many of these offspring do you predict will have red eyes? Show your work using a Punnett square. [Use letters R and r to designate the alleles]
Q: An allosteric activator or inhibitor O a. Competes with substrate for enzyme binding O b. Shifts the…
A: Given: Enzymes are the molecules that act as biocatalysts, aids biological and biochemical reactions…
Q: Briefly describe why a cell would need a family of chaperone proteins called “heat shock proteins”…
A: Heat shock protein or HSPs are basically a group of different proteins. These are very important for…
Q: How many ATP are produced from a triglyceride containing three 14 carbon fatty acids?
A: Beta oxidation Beta oxidation is the process of the breakdown of fatty acid molecules which as a…
Q: Explain why the yield of ATP is high in oxidative phosphorylation as compared to other stages.
A: Answer :- Adenosine 5′-triphosphate, abbreviated as ATP and generally written without the 5′-, is a…
Q: How do antibodies work to eradicate pathogens?
A: Antibodies can be referred to as specialized Y-shaped proteins which have the ability to degrade the…
Q: What is the most probable cause of the patient’s elevated urea nitrogen?
A: The patient has the conditions of chronic renal failure, diabetes, heart failure, anaemia, HTN. The…
Q: A 43-year-old man is diagnosed with chronic myeloid leukemia (CML) and started on standard imatinib…
A: Chronic Myeloid Leukemia is a blood cancer associated with BCR ABL translocation resulting in…
Q: A 32-year-old woman who are suffering from thyrotoxicosis a biopsy of the thyroid gland has shown…
A: Introduction :- Hassall's corpuscles are composed of a structureless eosinophilic mass surrounded by…
Q: In a tautomeric shift Multiple Choice it is always adenine that is changed. final bonding…
A: Nucleic acid bases exhibit keto-enol and amino-imino prototropic tautomerism due to the presence of…
Q: Press the hotspot that indicates a human activity that adds carbon dioxide to the atmosphere. CARBON…
A: Human activity that results in carbon dioxide emission is :-
Q: To explain: The difference between sexual and asexual reproduction and describe the advantages of…
A: Reproduction is the biological process of producing offspring for their parents. It is an essential…
Q: Medium/test Used Negative result Indicators, key regents, or key ingredients Positive result…
A: Dear student as per Bartleby policy i can solve first three parts only. Please post the remaining…
Q: Define and describe the stressors that may induce Artemia cysts to a state of dormancy How does the…
A: Introduction Artemia, popularly known as brine shrimp, is a genus of aquatic crustaceans. Artemia is…
Q: Consider the following protein sequence as an α helix:…
A: The sequence and identity of amino acids of a polypeptide chain make its primary structure.
Q: ORIGIN 1 acacttgctt ctgacacaac cgtgttcact agcaactaca caaacagaca ccatgctgac 61 tgctgaggag aaggctgccg…
A: The gene contains information to code for specific proteins in the form of the nucleotide sequence.…
Q: What features distinguish the amoebozoa from the rhizarians?
A: Protists are the unicellular organisms that are eukaryotes.
Q: acrial sporophyte alternation of generation antheridjum collumella cuticle elaters hydroids…
A: Plants are photosynthetic , autotrophic organism that belongs to plant kingdom . It mainly comprises…
Q: Which of the following applies to quaternary structure? O a. It has two alpha and two beta subunits…
A: Introduction The three-dimensional arrangement of atoms in an amino acid-chain molecule is known as…
Q: To explain: Why do seedlings that germinate in a fully darkened room grow taller than seedlings of…
A: Every living thing is hardwired to thrive in its own environment. Nonetheless, they require a number…
Q: What is a clitoris
A: It is the most sensitive region in the female reproductive system. It is a bulb shaped sexual…
Q: Why should people care about the article "Stopping pandemics before they start: Lessons learned from…
A: SAR-COV-2 virus is a member of a large family of coronavirus. It affects the respiratory system of…
Q: Which of the following characteristics is true for the inner section of a membrane? O hydrophilic O…
A: Introduction Lipids:- Lipids are oily or greasy nonpolar molecules, stored in the adipose tissue of…
Q: Why is the nickname "dark reactions" not entirely correct for the chemical stage of photosynthesis?
A: Introduction - 6CO2 + 6H2O = C6H12O6 + 6O2 is a typical representation of photosynthesis. This…
Q: homozygous for his teeth, what are the chances of passing on his toothy smile to thor 22. Some…
A: Teeth is encoded by single gene. The single gene has two alleles. T and t are two alleles of a…
Q: What is the mechanism behind the success of vaccines to eradicate or reduce infectious diseases such…
A: Vaccination refers to the process of immunizing individuals before they get infected with a disease.…
Q: Explain the process of mRNA to DNA translation
A: The second phase of protein production is translation. It happens after transcription when DNA…
Q: A diploid cell has 28 chromosomes in G2. Which of the following is NOT true of this cell? This cell…
A: Answer: NOT TRUE option: This cell contains 56 chromosomes in Anaphase.
Q: What is the purpose on an expression vector? O To produce viable phage for infection O To provide a…
A: Introduction A vector is any particle (plasmids, cosmids, Lambda phages, etc.) that is used to…
Q: d) Identify a passive tissue that could be exposed to continued plastic stress (deformation).…
A: In mechanics, muscles have two primary properties: passive and active. When the muscle is extended…
Q: Which of the following are involved in photosynthesis in plants and algae? chloroplasts CO2 water
A: Photosynthesis is an important method for inbound living organisms. students and researchers…
Q: diagram that explains the core concept of flow down gradients in the urinary system/kidneys?
A: Urinary system The urinary system comprises the kidneys, urinary bladder, ureters and urethra. Its…
Q: What is the mechanism for lymphocyte maturation so that lymphocytes will respond to non-self cells…
A: Introduction:- White blood cells, or lymphocytes, are one of the body's main types of immune cells.…
Q: What term describes the substance that is bound by an enzyme and converted to product? O a. Coenzyme…
A: Enzymes are proteinaceous substances that enhances the rate of metabolic reactions in our body.…
Q: Genetics
A: A branch of biology that deals with heredity and variation of organisms is called genetics. Mendel…
Q: Key properties of proteins include: O a. A wide range of functional groups and an ability to possess…
A: A protein is the large biomolecule (macromolecule)made up of amino acids subunits.
Q: What is structural variation of genomes? Describe the mechanisms that create structural variants,…
A: Structural variations are referred to variation or difference in the structure of chromosome of…
Q: Scientists at the Global Footprint Network calculate the energycomponent of our ecological footprint…
A: Ecological foot print measures the utilization of natural resources.Ecological foot print depends on…
Q: Which are considered Zoonotic diseases? Select all that apply. O Ebola O HIV O Rabies Hantavirus…
A: Disease is a kind of harmful condition which disturb or impairs functioning of body part or whole…
Q: 2.) One experimental tool used in the biological research and in clinical settings is called…
A: FACS/ Fluorescence-activated cell sorting (FACS) is a specialized type of flow cytometry, which…
Q: Key properties of proteins include: O a. A wide range of functional groups and an ability to possess…
A: Proteins are large biomolecules and macromolecules that comprise one or more long chains of amino…
Q: Olivia is a wilderness tour guide and spends her day hiking in the mountains. She uses 412 moles of…
A: As per question, Olivia uses 412 mol of ATP. The source of ATPs to be considered are the fats…
Q: 5' GTGCTAGCGGGAATGAGCTGGGATACTAGTAGGGCT 3 33' САCGATCGCCCTTACТCGАСССТАТGATCАТССCGA 5' Template…
A: The DNA or deoxyribonucleic acid is the genetic material in living organisms. DNA contain genes that…
Q: Question 88 How is a child with Type I diabetes similar to a child who is starving? Mark all that…
A:
Q: greater omentum [Choose Jh [ Choose] Parietal peritoneum holds the small intestines medial borrder,…
A: Digestive system is responsible for uptaking of food and digestion and absorption of food. The…
Q: 2 Fraternal twins are nonidentical siblings that form wheen two eggs mature, are released, and are…
A: FSH is also known as Follicle Stimulating Hormone. In women, FSH helps manage the menstrual cycle…
Q: List and describe the 6 stages of phagocytosis.
A: Introduction :- Phagocytosis is a cellular process that involves the ingestion and elimination of…
Q: The small opening in the integument(s) of the angiosperm egg sac through which the pollen tube…
A: Answer is e. The micropyle
Q: 6. You perform a high throughput DNA sequencing reaction on chromosome number 1 from a newly…
A: a)Arranging the fragments with overlapping sequences on the fragments ends. 2.GGCTATTTCGCCG 4.…
Q: Describe the conjunctiva and state its function. Name the primary glands of the endocrine system…
A: Conjunctiva: The conjunctiva is basicay a part of eye. It's a losse connective tissue which…
Q: Plant species with male and female flowers borne on separate plants are termed monocots monoecious…
A: The plant which bears both male and female flowers on separate individual are known as Dioecious…
you perform a cross of two heterozygous, red-eyed flies. They have 100 offspring. How many of these offspring do you predict will have red eyes? Show your work using a Punnett square. [Use letters R and r to designate the alleles]
Trending now
This is a popular solution!
Step by step
Solved in 2 steps with 2 images
- How would I figure this out using a punnett square? Next, you perform a cross of two heterozygous, red-eyed flies. They have 100 offspring. How many of these offspring do you predict will have red eyes? Show your work using a Punnett square. [Use letters R and r to designate the alleles].type P = n! (p)* (q)"* х! (n - х)! Practice Problem: You cross a true-breeding pea plant with red flowers to a true-breeding pea plant with white flowers. All of your offspring have red flowers. Which gene is dominant? Why? What is the genotype of your offspring? You then cross the offspring to each other. What ratio do you expect? Why? You count 1000 plants and look at their flowers. Your results are as follows: 740 red 260 white Does this follow a simple Mendelian inheritance pattern? Why or why not? DADT 2 MEA SUDI ND D LUT IONSIf a red flower is crossed with a white flower to produce an offspring with red and white petals, what is the relationship between the alleles for flower color? show your solution using punett square
- The table below shows the progeny of a test cross of a heterozygote (JjBbRr). Each row shows the number of progeny that inherited each combination of alleles from the heterozygous parent. You've already determined the gene order (B is in the middle) and labeled each type of progeny. Using this information, what is the recombination frequency between J and B? Alleles: Type: Count: J B R Parental 132 j b r Parental 135 J b R DCO 15 j B r DCO 11 J b r SCO (J-B) 59 j B R SCO (J-B) 55 J B r SCO (B-R) 38 j b R SCO (B-R) 40 Group of answer choices 0.214 0.235 0.289 the correct answer is not available. 0.503 0.14Fruit fly body color is wild type (meaning normal) Gray = B+ and black = b Fruit fly wing type is wild type normal wings = vg+ and vg = vestigial A fly which was heterozygous for both traits was crossed with a fly that was recessive for both traits. Write the genotype and phenotype that would be expected from this cross. Write the genotype and phenotype percentages that would be expected from this cross.Produce a Punnett square to illustrate the dihybrid cross described below (NOTE: It is the same story as in question 9, above so you may use the square that you produced in answer to question 9 to answer this question, you do not need to draw it twice). use it to fill in the blanks in the answer text below. NOTE: please type in whole numbers only, no symbols, no letters, no spaces. There are two common alleles for the TAS2R38 gene on Chromosome 7. This gene encodes a seven-transmembrane G-protein coupled receptor. This receptor controls the ability to taste glucosinolates. Phenylthiocarbamide (PTC) is a synthetic glucosinolate. The recessive TAS2R38 allele produces a non-functional receptor. The father in this dihybrid cross is heterozygous for these alleles, meaning that he can taste PTC. The mother is homozygous recessive, meaning that she cannot taste PTC The father has X-Linked Protoporphyria which means that he is very sensitive to sunlight exposure, he is hemizygous for the…
- A friend tells you that her biological father has an inherited disorder determined by a dominant allele but neither your friend nor her three siblings are affected. Is this possible? If not, why not? If so, explain how it is possible. For the toolbar, press ALT+F10 (PC) or ALT+FN+F10 (Mac). BIUS Paragraph Arial 14px A V x² X, ABC 田 田 | 国田用田 Ť {;} III !!! +)If a red flower was mated with white flower, they produced a pink flower, what could you say about the relationship between the alleles of the red and white flowers? show your solution using punnet squarept pt PT PPTt purple tall PpTt purple tall Pt Pptt purple white Pptt purple white Using any two plants resulting from your test cross (even two of the same genotypes if you would prefer), perform a second cross. Provide a Punnett square demonstrating this dihybrid cross.What are the ratios for each genotype in the resulting offspring? What are the ratios for each phenotype? Your answer should clearly indicate the genotype and phenotype each portion of the ratio is referring to
- Produce a Punnett square to illustrate the dihybrid cross described below (NOTE: It is the same story as in question 9, above so you may use the square that you produced in answer to question 9 to answer this question, you do not need to draw it twice). use it to fill in the blanks in the answer text below. NOTE: please type in whole numbers only, no symbols, no letters, no spaces. There are two common alleles for the TAS2R38 gene on Chromosome 7. This gene encodes a seven-transmembrane G-protein coupled receptor. This receptor controls the ability to taste glucosinolates. Phenylthiocarbamide (PTC) is a synthetic glucosinolate. The recessive TAS2R38 allele produces a non-functional receptor. The father in this dihybrid cross is heterozygous for these alleles, meaning that he can taste PTC. The mother is homozygous recessive, meaning that she cannot taste PTC The father has X-Linked Protoporphyria which means that he is very sensitive to sunlight exposure, he is hemizygous for the…SEATWORK Symbols (for pea plant traits): • T: Tall t: short Analyze the following problems. Determine the possible genotypes, genotypic ratio, phenotypes, and phenotypic ratio from the genetic cross. Show your solution through a Punnett square. Use the symbols provided. • R: Round seeds r: wrinkled seeds • Y: Yellow seeds y: green seeds • P: Purple flower p: white flower 1) Cross a homozygous dominant tall and homozygous round seed pea plant with a heterozygous tall and heterozygous round seed pea plant. 2) Cross a pea plant that is heterozygous for purple flowers and homozygous dominant for yellow seeds with a pea plant that is heterozygous for purple flowers and homozygous recessive for green seeds. 3) Cross a pea plant that is short and has green seeds with a pea plant that is heterozygous tall and has heterozygous yellow seeds.We have crossed true-breeding flies today. Wild type to mutant. Their phenotypes were wt and vg se. (Let’s not worry about males and females for now, just assume both genes are autosomal, which is normal in a Mendelian experiment). The results of a cross are phenotypes. I will be asking you for numbers or a ratio of phenotype numbers you expect to see in the offspring from this cross. To answer this, you’ll need to start with the genotypes of parents, then write their gametes, then write the offspring genotypes, then get the phenotypes based on them. Predict the results of this cross: In case both mutations are recessive; In case both mutations are dominant; In case vestigial wings are recessive and the sepia eyes are dominant.