Essentials of Genetics (9th Edition) - Standalone book
9th Edition
ISBN: 9780134047799
Author: William S. Klug, Michael R. Cummings, Charlotte A. Spencer, Michael A. Palladino
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 11, Problem 21PDQ
Summary Introduction
To review:
The formation of a closed ring by the lambda phage DNA (deoxyribonucleic acid) in a host cell.
Introduction:
Lambda phage is an enterobacteria phage that infects Escherichia coli. It is made up of a head, a tail, and tail fibers, and the phage double-strand linear DNA is enclosed in the head. It performs both lytic and lysogenic cycles in the host. In the lytic cycle, the replication of lambda phage is followed by host cell lysis, and in the lysogenic cycle, the viral genome gets integrated into the host genome and replicates there.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
Give the RNA molecule sequence transcribed from the following DNA sequence of a eukaryotic gene and with the correct 5' and 3' ends.
DNA:
5'-ATAGGGCATGT-3'
3'-TATCCCGTACA-5' <--- template strand
Group of answer choices
5'-ATAGGGCATGT-3'
3'-UAUCCCGUACA-5'
5'-AUAGGGCAUGU-3'
3'-TATCCCGTACA-5'
#1 HindII --- 5’ GTC ↓ GAC 3’
5’ ACGACGTAGTCGACTTATTAT GTCGACCCGCCGCGTGTCGACCATCA 3’
3’ TGCTGCATCAGCTGAATAATACAGCTGGGCGGCGCACAGCTGGTAGT 5’
Restriction enzyme:
Recognition sequence:
Number of pieces of DNA:
Type of cut:
Below is a diagram of the general structure of the bacteriophagel chromosome. Speculate on the mechanism by which it forms aclosed ring upon infection of the host cell.
5'GGGCGGCGACCT:double@stranded region-3'
3'- double@stranded region:CCCGCCGCTGGA5'
Chapter 11 Solutions
Essentials of Genetics (9th Edition) - Standalone book
Ch. 11 - CASE STUDY | Art inspires learning A genetics...Ch. 11 - Prob. 2CSCh. 11 - Prob. 3CSCh. 11 -
HOW DO WE KNOW?
1. In this chapter, we focused on...Ch. 11 - Review the Chapter Concepts list on p. 199. These...Ch. 11 - Prob. 3PDQCh. 11 - Describe how giant polytene chromosomes are...Ch. 11 - What genetic process is occurring in a puff of a...Ch. 11 - Prob. 6PDQCh. 11 - Why might we predict that the organization of...
Ch. 11 -
8. Describe the sequence of research findings...Ch. 11 - Prob. 9PDQCh. 11 - Prob. 10PDQCh. 11 - Provide a comprehensive definition of...Ch. 11 - Prob. 12PDQCh. 11 - Define satellite DNA. Describe where it is found...Ch. 11 - Prob. 14PDQCh. 11 -
15. Mammals contain a diploid genome consisting...Ch. 11 - Prob. 16PDQCh. 11 - Prob. 17PDQCh. 11 - Prob. 18PDQCh. 11 - Prob. 19PDQCh. 11 - The human genome contains approximately 106 copies...Ch. 11 - Prob. 21PDQ
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- The beginning of the hexose kinase gene's sequence can be found below, the +1 nucleotide is underlined and bolded. It also contains an origin of replication (ORI) which is found at position 30. 1 20 ORI 40 60 5'..TTCGAGCTCTCGTCGTCGAGATACGCGATGATATTACTGGTAATATGGGGATGCACTATC...3’ 3'...AAGCTCGAGAGCAGCAGCTСТАТGCGCTАСТАТААTGACCATTATАССССТАСGTGATAG...5' promoter 2a. Assume that replication has been initiated at that ORI. Provide the sequence of the primer that is complementary to the DNA in each of the following positions. Site A - binding to the top strand of the DNA at position 20 – 30 5' 3' Site B - binding to the top strand of the DNA at position 31 – 41 5' 3' 2b. Replication is occurring normally in these cells; would you expect to find a primer in both positions? Why or why not?arrow_forwardThe beginning of the hexose kinase gene's sequence can be found below, the +1 nucleotide is underlined and bolded. It also contains an origin of replication (ORI) which is found at position 30. 20 ORI 40 60 5'..TTCGAGCTCTCGTCGTCGAGATACGCGATGATATTACTGGTAATATGGGGATGCACTATC...3' 3'...AAGCTCGAGAGCAGCAGCTСТАТGCGCTАСТАТААTGACСАТТАТАССССТАСGTGATAG...5" promoter a. Assume that replication has been initiated at that ORI. Provide the sequence of the primer that is complementary to the DNA in each of the following positions. Site A - binding to the top strand of the DNA at position 20 – 30 5' 3' Site B - binding to the top strand of the DNA at position 31 – 41 5' 3'arrow_forwardThe beginning of the hexose kinase gene's sequence can be found below, the +1 nucleotide is underlined and bolded. It also contains an origin of replication (ORI) which is found at position 30. 1 20 ORI 40 60 5'.TTCGAGCTCTCGTCGTCGAGATACGCGATGATATTACTGGTAATATGGGGATGCACTATC...3' 3'.AAGCTCGAGAGCAGCAGCTCTATGCGCTACTATAATGACCATTATACCCCTACGTGATAG...5' promoter 2a. Assume that replication has been initiated at that ORI. Provide the sequence of the primer that is complementary to the DNA in each of the following positions. d Site A - binding to the top strand of the DNA at position 20 – 30 5' 3' Site B - binding to the top strand of the DNA at position 31 -41 5' 3' 2b. Replication is occurring normally in these cells; would you expect to find a primer in both positions? Why or why not?arrow_forward
- 5' 3' ORF1 ORF2 ORF3 ORF4 ORF5 1. Above are pictured 2 operons, one that includes ORF1 and OFR2 and is transcribed using the top DNA strand as the template, and the other includes ORF3, ORF4, and ORF5 and is transcribed using the bottom DNA strand as the template. 3' 5' a) Complete this diagram by using arrows (4) to indicate the position and direction of the promoter(s). It doesn't matter if you draw the arrows above or below the ORFS as long as they are pointing the right way. b) Underline and label with "RBS" the ribosome binding site(s). c) How many different RNA molecules will be made from this region of DNA? d) How many different proteins will be made from this region of DNA? e) How many promoters are found in this region of DNA? f) How many stop codons are found in this region of DNA? g) What assay would you use to investigate the protein accumulation of these ORFs?arrow_forwardProvide the complementary strand and the RNA transcription product for the following DNA template segment:5'-AGGGGCCGTTATCGTT-3'arrow_forwardTranscribe the following strand of DNA into RNA: 5'-AAGTTCGA-3'arrow_forward
- when various strains of lambda phage are seeded on a lawn of e.coli, they can form clear or turbid plaques. Explain the difference between the two types of plaques. can all bacteriophage form clear and turbid plaques?arrow_forward#4 BamI --- 5’ CCTAG ↓G 3’ 5’ ACGCCTAGGACGTATTATCCTAGGTAT CCGCCGCCGT CATCA 3’ 3’ TGCGGATCCTGCATAATAGGATCCATAGGCGGCGGCAGTAGT 5’ Restriction enzyme: Recognition sequence: Number of pieces of DNA: Type of cut:arrow_forwardThis is part of the Escherichia coli DNA sequence that contains an inverted repeat. (Note: top strand is the coding strand). 5'-AACGCATGAGAAAGCCCCCCGGAAGATCACCTTCCGGGGGCTTTATATAATTAGC-3' 3'-TTGCGTACTCTTTCGGGGGGCCTTCTAGTGGAAGGCCCCCGAAATATATTAATCG-5' (i) Draw the structure of hairpin loop that will be formed during the end of transcription. (ii) Describe the function of the hairpin loop during transcription.arrow_forward
- #3 HaelII --- 5’ CC ↓ GG 3’ 5’ ACGCCGGCCGTATTAT CCGGATCCGCCG CCGGCTGTCCCGGATCA 3’ 3’ TGCGGCCGGCATAATAGGCCTAGGCGGCGGCCGACAGGGCCTAGT 5’ Restriction enzyme: Recognition sequence: Number of pieces of DNA: Type of cut:arrow_forwardA cell infected with lambda bacteriophage can follow one of two pathways: the lytic or lysogenic pathway. Describe the similarities and differences between the structure of cI and Cro, paying particular attention to the features that allow them to carry out their different functions.arrow_forwardWhat would happen to the ability of bacteriophage λ tolyse a host cell if it acquired a mutation in the OR bindingsite for the Cro protein? Why?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Genome Annotation, Sequence Conventions and Reading Frames; Author: Loren Launen;https://www.youtube.com/watch?v=MWvYgGyqVys;License: Standard Youtube License