Essentials of Genetics (9th Edition) - Standalone book
9th Edition
ISBN: 9780134047799
Author: William S. Klug, Michael R. Cummings, Charlotte A. Spencer, Michael A. Palladino
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 11, Problem 2PDQ
Review the Chapter Concepts list on p. 199. These all relate to how DNA is organized in viral, prokaryote, and eukaryote chromosomes. Write a short essay that contrasts the major differences between the organization of DNA in viruses and bacteria versus eukaryotes.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
Heinz Shuster collected the following data on the base composition of ribgrass mosaic virus (H. Shuster, in The Nucleic Acids: Chemistry andBiology, vol. 3, E. Chargaff and J. N. Davidson, Eds. New York: Academic Press, 1955). On the basis of this information, is the hereditary information of the ribgrass mosaic virus RNA or DNA? Is it likely to be single stranded or double stranded?
Heinz Shuster collected the following data on the base composition of ribgrass mosaic virus (H. Shuster, in The Nucleic Acids: Chemistry and Biology, vol. 3, E. Chargaff and J. N. Davidson, Eds. New York: Academic Press, 1955). On the basis of this information, is the hereditary information of the ribgrass mosaic virus RNA or DNA? Is it likely to be single stranded or double stranded? Percentage A G C T U Ribgrass mosaic virus 29.3 25.8 18.0 0.0 27.0
Describe the “end-replication problem” in eukaryotes. How is itresolved?
Chapter 11 Solutions
Essentials of Genetics (9th Edition) - Standalone book
Ch. 11 - CASE STUDY | Art inspires learning A genetics...Ch. 11 - Prob. 2CSCh. 11 - Prob. 3CSCh. 11 -
HOW DO WE KNOW?
1. In this chapter, we focused on...Ch. 11 - Review the Chapter Concepts list on p. 199. These...Ch. 11 - Prob. 3PDQCh. 11 - Describe how giant polytene chromosomes are...Ch. 11 - What genetic process is occurring in a puff of a...Ch. 11 - Prob. 6PDQCh. 11 - Why might we predict that the organization of...
Ch. 11 -
8. Describe the sequence of research findings...Ch. 11 - Prob. 9PDQCh. 11 - Prob. 10PDQCh. 11 - Provide a comprehensive definition of...Ch. 11 - Prob. 12PDQCh. 11 - Define satellite DNA. Describe where it is found...Ch. 11 - Prob. 14PDQCh. 11 -
15. Mammals contain a diploid genome consisting...Ch. 11 - Prob. 16PDQCh. 11 - Prob. 17PDQCh. 11 - Prob. 18PDQCh. 11 - Prob. 19PDQCh. 11 - The human genome contains approximately 106 copies...Ch. 11 - Prob. 21PDQ
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- In bacteriophages and bacteria, the DNA is almost always organized into circular (closed loops) chromosomes. Phage l is an exception, maintaining its DNA in a linear chromosome within the viral particle. However, as soon as this DNA is injected into a host cell, it circularizes before replication begins. What advantage exists in replicating circular DNA molecules compared to linear molecules, characteristic of eukaryotic chromosomes?arrow_forward11:29 Protein 6-10092015113530.pdf https:api.schoology.comv1attachment169963838... Name Class Date 2. How are enzymes involved in this process? 3. hаppens anzips"? 4. Why is it important that exact copies of DNA be made? 5. Suppose that a sequence of one DNA strand is T-A-C-A-A-C-G-T-G. What is the corresponding sequence on the other strand? E Concept Mapping The construction of and theory behind concept mapping are discussed on pages vil-ix in the front of this Study Guide. Read those pages carefully. Then consider the concepts presented in Section 7-1 and how you would organize them into a concept i page 74. Notice that the concept map has been started for you. Add the key Now look at the concept map for Chapter 7 on concepts you are important Secti When you have finished the chapter, you will have a completed concept map. 69 1 of 1arrow_forwardTo test patients for COVID19, lab workers will first convert all the RNA molecules extracted from a nasal swab to a double-stranded DNA copy (dsDNA). If the virus is present, its genomic sequence should be in some of the new dsDNA molecules. Part 1) A region of COVID genomic DNA sequence is shown below. Following convention, only the top strand is shown. Copy/paste the sequence into the text box and create the second strand. Be sure to label its ends. (You may need to reduce the font size so that it doesn't wrap around) AAGATCACATTGGCACCCGCAATCCTGCTAACAATGCTGCAATCGTGCTACAACTTCCTC Part 2) To test for the presence of COVID DNA sequence, lab workers use single-stranded DNA oligonucleotides as probes (short pieces of DNA that do not have a partner strand). If the two strands of DNA that you drew were separated from each other, where would the shorter DNA strand shown below be able to form continuous base pairs? Highlight that region in your dsDNA model. TGTAGCACGATTGCAGCATTG Note: If you…arrow_forward
- Name an important difference in the replication of circular DNA versus linear double-stranded DNA.arrow_forwardThere are 6 parts to this question: This is a follow up to the prior question regarding the replication of the DNA strand below. The DNA strand is here for your reference and you do not need to do anything with or to it. TC GATATCGG AGCTATAGCC c) what enzyme separated the parental DNA template strands, d) what bonds were broken? e) what enzyme replicates DNA f) before DNA can be replicated/copied, what must be laid down to allow the enzyme in "e" to replicated the DNA (be specific)? g) our DNA is replicated in many "pieces", what enzyme connects these many "pieces" into one continuous DNA strand that becomes the sister chromatid? h) during what specific phase of the cell cycle does this DNA replication process occur? (This should be a review question from last topics we covered).arrow_forwardI. Compare how Bacteria, Archaea, and Eukaryotes differ on each of the following aspects of DNA replication: 1. How do the number and types of DNA polymerase differ between these three groups? 2. How does the physical location in the cell of DNA replication differ between these three groups? 3. Are there differences between these three groups in the timing of when DNA replication occurs in cells? 4. How does origin of replication differ in terms of number and location between these three groups?arrow_forward
- A major difference between prokaryotes and eukaryotes is the presence of a nucleus. What advantages and disadvantages may occur with having a cell’s genome packaged in a nucleus?arrow_forwardExplain in not more than 5 sentences. If deoxyribonucleotides that lack the 3’-OH groups are added during the replication process, what do you expect will occur?arrow_forward22.124 Give two reasons why bacterial cells am wred for recombinant DNA procedures. Nucleic Acids 1015 22.125 What role do plasmids play in recombinant Polymerase Chain Reaction (Section 22.15) 22.131 What is the function of the polymerase chain DNA procedures? 22.126 Describe what occurs when a particular restric- reaction? tion enzyme operates on a segment of double- stranded DNA. 22.127 Describe what happens during transformation. 22.128 How are plasmids obtained from E, coli bacte- 22.132 What is the function of the enzyme DNA polymerase in the PCR process? 22.133 What is a primer and what is its function in the PCR process? 22.134 What are the four types of substances needed to carry out the PCR process? ria? 22.129 A particular restriction enzyme will cleave DNA Sequencing (Section 22.16) DNA between A and A in the sequence AAGCTT in the 5'-to-3' direction. Draw a dia- gram showing the structural details of the "sticky ends" that result from cleavage of the following DNA segment.…arrow_forward
- Answer the following questions: 1.)Explain in detail, how DNA replication occurs, include DNA polymerase, RNA polymerase , primase and ligase. 2.) Explain transcription and translation, explain the roles of chromosomes DNA , messenger RNA, transfer RNA, and ribosomal RNA in the process as well as how complementary base pairing is included. 3.) Illustrate a hypothetical genetic code by spelling out the nucleotide codons of a segement of mRNA and indicating the sequence of amino acids that could be coded for in the process of protein synthesis.arrow_forward26-27) List all the antibiotics in the above table that work through inhibiting replication (if there are none listed please indicate so) 28-29) List all the antibiotics in the above table that work through inhibiting protein synthesis (if there are none listed please state thatarrow_forward1.1 Which of the following enzymes is the main replication enzyme in prokaryotes? 1. DNA polymerase I 2. DNA polymerase II 3. DNA polymerase III 4. Topoisomerase 5. DNA ligase 1.2 The process for forming RNA from DNA is called 1. replication 2. transcription 3. reverse transcription 4. translation 5. RNA replication 1.3 What is the purpose of the Shine-Dalgarno sequence? 1. facilitates the binding of mRNA to the 30S subunit 2. facilitates the biding of IF1 and IF3 bind to the 30S subunit 3. catalyses peptidyl transfer 4. ensures release factors bind to the appropriate sites 5. facilitates elongation factors functioning 10. What is the correct citation for this article https://doi.org/10.1016/i.pep.2018.03.006 based on the instructions provided for this module? 1. 2. Russell et al, 2018 Russell and Gildenhuys, 2018 Russell, B.L., et al 2018 Russell, B.L. and Gildenhuys, S. 2018 Bonnie et al 2018 3. 4. 5.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Bacterial Genomics and Metagenomics; Author: Quadram Institute;https://www.youtube.com/watch?v=_6IdVTAFXoU;License: Standard youtube license