Concepts of Genetics (12th Edition)
12th Edition
ISBN: 9780134604718
Author: William S. Klug, Michael R. Cummings, Charlotte A. Spencer, Michael A. Palladino, Darrell Killian
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 18, Problem 28ESP
While miRNA response elements (MREs) may be located anywhere within an mRNA, they are most often found outside the coding region in the 5′ or 3′ UTR. Explain why this is likely the case given that miRNAs often target more than one mRNA.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
miRNAs target endogenous mRNAs in a sequence-specific manner. Explain, conceptually, how one might identify potential mRNA targets for a given miRNA if you only know the sequence of the miRNA and the sequence of all mRNAs in a cell or tissue of interest.
MicroRNAs are small RNA molecules that bind to the 3′ end of mRNA and suppress translation . Some eukaryotic mRNAs have internal ribosome-binding sites downstream of the 5′ cap, where ribosomes normally bind. In one investigation, miRNAs did not suppress translation by ribosomes that had attached to internal ribosomebinding sites ). What does this finding suggest about how miRNAs suppress translation?
Consider the following sequence fragment of an mRNA. Which of the miRNAS below would be competent for gene silencing?
5'-AUGCAAGCAUUGGCCAAGCUU-3'
5'-AUGCAAGCAUUGGCCAAGCUU-3
5'-UACGUUCGUAACCGGUUCGAA-3'
5'-AAGCUUGGUUAAUGCUUGCAU-3'
5'-UUCGAACCAAUUACGAACGUA-3'
3'-UUCGAACCAAUUACGAACGUA-5
3'-AUGCAAGCAUUGGCCAAGCUU-5'
Chapter 18 Solutions
Concepts of Genetics (12th Edition)
Ch. 18 - Some mutations in the tra gene of Drosophila cause...Ch. 18 - Some scientists use the analogy that the...Ch. 18 - Consider the example that actin mRNA localization...Ch. 18 - What is alternative splicing, where does it occur,...Ch. 18 - What role might the expanded tri- and...Ch. 18 - DM1 is characterized by a phenomenon known as...Ch. 18 - HOW DO WE KNOW? In this chapter, we focused on how...Ch. 18 - CONCEPT QUESTION Review the Chapter Concepts list...Ch. 18 - List three types of alternative splicing patterns...Ch. 18 - Consider the CT/CGRP example of alternative...
Ch. 18 - Explain how the use of alternative promoters and...Ch. 18 - Explain how a tissue-specific RNA-binding protein...Ch. 18 - The regulation of mRNA decay relies heavily upon...Ch. 18 - Nonsense-mediated decay is an mRNA surveillance...Ch. 18 - AU-rich elements (AREs) are cis-elements in mRNAs...Ch. 18 - What are processing bodies (P bodies), and what...Ch. 18 - In 1998, future Nobel laureates Andrew Fire and...Ch. 18 - Present an overview of RNA interference (RNAi)....Ch. 18 - RNAi may be directed by small interfering RNAs...Ch. 18 - Prob. 14PDQCh. 18 - In principle, RNAi may be used to fight viral...Ch. 18 - Prob. 16PDQCh. 18 - Prob. 17PDQCh. 18 - Prob. 18PDQCh. 18 - Prob. 19PDQCh. 18 - How is it possible that a given mRNA in a cell is...Ch. 18 - Prob. 21PDQCh. 18 - Prob. 22PDQCh. 18 - Prob. 23PDQCh. 18 - Prob. 24ESPCh. 18 - Prob. 25ESPCh. 18 - Mutations in the low-density lipoprotein receptor...Ch. 18 - RNA helicases are a class of proteins that bind...Ch. 18 - While miRNA response elements (MREs) may be...Ch. 18 - RNAi is currently being tested as a therapeutic...Ch. 18 - The localization and translational control of...Ch. 18 - Explain how the expression of a single gene can be...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- What are the differences between miRNA and siRNA? (Select all that apply.) OmiRNAs carry the genetic information from the DNA in the nucleus directly to the cytoplasm, and siRNAs are involved in the degradation of specific mRNA molecules. miRNAs are from 22 to 30 bases long, and siRNAs are 22 bases long. O miRNAs carry the genetic information from the DNA in the nucleus directly to the cytoplasm, and siRNAs help with the processing of the initial mRNA transcribed from DNA into a mature form. miRNAs prevent translation of certain mRNAs, and siRNAs are involved in the degradation of specific mRNA molecules. miRNAs are 20 to 22 bases long, and siRNAs are from 20 to 30 bases long.arrow_forward1) Considering how readily RNA folds to form a secondary structure, why isn’t it used to store genetic information rather than double-stranded DNA? Cite multiple reasons. 2) Do miRNA and siRNA both derive from the same source? Explain.arrow_forwardDuring periods of starvation, translation of only vital mRNAs must occur inside a cell. Explain how eIF2 can mediate both the suppression of translation of non-essential mRNAs and ensure that essential mRNAs continues to be translated.arrow_forward
- Why are miRNAs called noncoding RNAs? Explain how they participate in gene regulation.arrow_forwardMany uridine molecules are inserted into some mitochondrial mRNAs in trypanosomes. The uridine residues come from the poly(U) tail of a donor strand. Nucleoside triphosphates do not participate in this reaction. Propose a reaction mechanism that accounts for these findings. (Hint: Relate RNA editing to RNA splicing.)arrow_forwardWhat would be a possible result if a miRNA that perfectly complemented E3 ligase was successfully processed in the cell?arrow_forward
- Knowing that the genetic code is almost universal, a scientist uses molecular biological methods to insert the human β-globin gene (Shown in Figure 17.11) into bacterial cells, hoping the cells will express it and synthesize functional β-globin protein. Instead, the protein produced is nonfunctional and is found to contain many fewer amino acids than does β-globin made by a eukaryotic cell. Explain why.arrow_forwardOne procedure of obtaining cDNA from mRNA is by using oligo(dT) primers. What are oligo(dT)s? Why does using them make sense based on the processing (or modification) of precursor mRNA to get mature mRNA?arrow_forwardMicroRNAs (miRNAs) are short, noncoding, single-stranded RNAs approximately 19-25 nucleotides in length that bind to mRNAs. Numerous protein-encoding genes are regulated by miRNAs, including those involved in the immune response. Research has shown that rejection of transplanted organs is associated with alterations in the expression of various genes. To determine whether a link exists between miRNA expression patterns and organ rejection, a team of scientists performed the following set of experiments. Experiment 1 MicroRNA levels were measured in the biopsy specimens of patients with normal transplanted kidneys and patients with kidneys that showed histologic features of acute rejection (AR). MicroRNA sequences are shown in Table 1. Table 1 Normalized miRNA levels miRNA Sequence miR-142-5p 5'-CAUAAAGUAGAAAGCACUACU-3' miR-155 5'-UUAAUGCUAAUCGUGAUAGGGGU-3' Nucleotide Sequences for Mature miRNAs miR-223 miR-10b 5'-UACCCUGUAGAACCGAAUUUGUG-3' let-7c miR-30a-3p 5'-CUUUCAGUCGGAUGUUUGCAGC-3'…arrow_forward
- What will be the overall anti-codon sequence in tRNA for this mRNA? 5’-GUAGCCUUAUCUAGCGAUCACCGUCCGUAUUACUAGUGGCCAGACUCUUUUCACCAUGUAUAGUUG-3’arrow_forwardIn table 21.1, the effects of injection of different types of RNA into wild type mice was examined. Explain why injection of the the miRNA to the Kit mRNA resulted in white feet and tails, but an injection of a non-specific mRNA had no effect.arrow_forwardThe amino acids, in one-letter symbols and no spaces, coded by the following mRNA sequence is 5’ AAUGGAACGUCGGUACUGCCAUCGCAUUAGUACCAUGGCAAGCUGAAGC 3’arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Bacterial Genomics and Metagenomics; Author: Quadram Institute;https://www.youtube.com/watch?v=_6IdVTAFXoU;License: Standard youtube license