Genetics: Analysis and Principles
6th Edition
ISBN: 9781259616020
Author: Robert J. Brooker Professor Dr.
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 20, Problem 13CONQ
What type of DNA structure is recognized by RecG and RuvABC? Do you think these proteins recognize DNA sequences? Be specific about what type(s) of molecular recognition these proteins can perform.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Define recognition sequence.
Which of the following set(s) of primers a–d couldyou use to amplify the following target DNA sequence, which is part of the last protein-coding exonof the CFTR gene?5′ GGCTAAGATCTGAATTTTCCGAG ... TTGGGCAATAATGTAGCGCCTT 3′3′ CCGATTCTAGACTTAAAAGGCTC ... AACCCGTTATTACATCGCGGAA 5′a. 5′ GGAAAATTCAGATCTTAG 3′;5′ TGGGCAATAATGTAGCGC 3′b. 5′ GCTAAGATCTGAATTTTC 3′;3′ ACCCGTTATTACATCGCG 5′c. 3′ GATTCTAGACTTAAAGGC 5′;3′ ACCCGTTATTACATCGCG 5′d. 5′ GCTAAGATCTGAATTTTC 3′;5′ TGGGCAATAATGTAGCGC 3′
A protein has the following amino acid sequence:
Met-Tyr-Asn-Val-Arg-Val-Tyr-Lys-Ala-Lys-Trp-Leu-Ile-His-Thr-Pro
You wish to make a set of probes to screen a cDNA library for the sequence that encodes this protein. Your probes should be at least 18 nucleotides in length.
Q. Which amino acids in the protein should be used to construct the probes so that the least degeneracy results?
Chapter 20 Solutions
Genetics: Analysis and Principles
Ch. 20.1 - 1. Homologous recombination refers to the exchange...Ch. 20.1 - During the molecular process of homologous...Ch. 20.1 - 3. A key difference between the original Holliday...Ch. 20.1 - Which of the following mechanisms can cause gene...Ch. 20.2 - 1. During site-specific recombination that occurs...Ch. 20.2 - Prob. 2COMQCh. 20.3 - Which of the following types of transposable...Ch. 20.3 - Prob. 2COMQCh. 20.3 - Prob. 3COMQCh. 20 - 1. Describe the similarities and differences...
Ch. 20 - Prob. 2CONQCh. 20 - 3. Which steps in the double-strand break model...Ch. 20 - Prob. 4CONQCh. 20 - Prob. 5CONQCh. 20 - Prob. 6CONQCh. 20 - Prob. 7CONQCh. 20 - 8. What is gene conversion?
Ch. 20 - Make a list of the differences between the...Ch. 20 - Prob. 10CONQCh. 20 - Prob. 11CONQCh. 20 - 12. According to the double-strand break model,...Ch. 20 - What type of DNA structure is recognized by RecG...Ch. 20 - Briefly describe three ways that antibody...Ch. 20 - 15. Describe the functions of the RAG1 and RAG2...Ch. 20 - According to the scenario shown in Figure 20.7,...Ch. 20 - Prob. 17CONQCh. 20 - Prob. 18CONQCh. 20 - 19. Why does transposition always produce direct...Ch. 20 - 20. Which types of TEs have the greatest potential...Ch. 20 - Prob. 21CONQCh. 20 - 22. Let’s suppose that a species of mosquito has...Ch. 20 - This chapter describes different types of TEs,...Ch. 20 - Prob. 24CONQCh. 20 - Prob. 25CONQCh. 20 - 26. What is the difference between an autonomous...Ch. 20 - 1. Briefly explain how McClintock determined that...Ch. 20 - The work of McClintock showed that the presence of...Ch. 20 - 3. In your own words, explain the term transposon...Ch. 20 - Prob. 4EQCh. 20 - 5. Gerald Rubin and Allan Spradling devised a...Ch. 20 - Make a list of the similarities and differences...Ch. 20 - Prob. 2QSDCCh. 20 - Prob. 3QSDC
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Below is a sequence of 540 bases from a genome. What information would you use to find the beginnings and ends of open reading frames? How many open reading frames can you find in this sequence? Which open reading frame is likely to represent a protein- coding sequence, and why? Which are probably not functioning protein-coding sequences, and why? Note: for simplicitys sake, analyze only this one strand of the DNA double helix, reading from left to right, so you will only be analyzing three of the six reading frames shown in Figure 19.4.arrow_forwardRefer to the DNA sequence provided: 3’ -TACTGAAGCGGCAGCCCCGCATGAGTAGACCTTACT-5’ a. What is the mRNA transcript of the anticoding strand of the DNA model? b. What is the amino acid sequence of the polypeptide chain that will be translated from the mRNA in (a)?arrow_forwardA protein has the following amino acid sequence: Met-Tyr-Asn-Val-Arg-Val-Tyr-Lys-Ala-Lys-Trp-Leu-Ile-His-Thr-Pro You wish to make a set of probes to screen a cDNA library for the sequence that encodes this protein. Your probes should be at least 18 nucleotides in length. Q. How many different probes must be synthesized to be certain that you will find the cDNA sequence that specifies the protein?arrow_forward
- What do you mean by cross-exon recognition complex ?arrow_forwardAs you should recall, DNA, when not being actively transcribed, has a double helical structure. This portion of the DNA has had the two strands separated in preparation of transcribing for a needed protein. The following is one of the two complimentary strands of DNA: 3' - AACCAGTGGTATGGTGCGATGATCGATTCGAGGCTAAAATACGGATTCGTACGTAGGCACT - 5' Q: Based on written convention, i.e. the 3'-5' orientation, is this the coding strand or the template strand? ______________________________ Q: Assuming this strand extends from base #1 to #61 (going left to right), interpret the correctly transcribed mRNA and translated polypeptide for bases 24 - 47: mRNA: ___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___- polypeptide chain: ________--________--________--________--________--________--________--________arrow_forwardWhere would you expect DNA-binding proteins to bind if they recognize a specific base sequence? What about DNA-binding proteins that do not recognize a base sequence?arrow_forward
- As part of a project investigating potential new drug targets in the fight against malaria, you are seeking to clone the gene for a protein from the malaria parasite Plasmodium falciparum. You wish to express this protein in BL21 (DE3) cells, a standard laboratory strain of Escherichia coli. After purification of your protein, you run an SDS-PAGE gel and notice that the major band has lower molecular weight than expected, so you fear you are getting a truncated version. (a) Give TWO possible causes of your protein becoming truncated. explainarrow_forwardAs part of a project investigating potential new drug targets in the fight against malaria, you are seeking to clone the gene for a protein from the malaria parasite Plasmodium falciparum. You wish to express this protein in BL21 (DE3) cells, a standard laboratory strain of Escherichia coli. After purification of your protein, you run an SDS-PAGE gel and notice that the major band has lower molecular weight than expected, so you fear you are getting a truncated version. 1. What technique could you use to confirm that you are obtaining a shortened version of your intended protein? explainarrow_forwardDescribe the basic structural features of DNA-binding proteins that allow them to recognize specific DNA sequences.arrow_forward
- A very common molecular biology research method is to analyze cell or tissue homogenates by SDS-polyacrylamide gel electrophoresis and immunoblotting (Western blot). What can we learn about a protein of interest from this type of analysis? More than one answer is correct. Options: Determine the tertiary structure of the protein of interest. Determine or verify the molecular weight of the protein of interest. Compare the levels of the protein of interest in two different cell types. Determine the amino acid sequence from the product ion spectrum. Determine the intracellular binding partners of the protein of interest.arrow_forwardBased on the work presented in Boch et al., 2009 Science, choose all of the DNA sequences that can be bound by a TAL effector with the following repeat structure: NG-HD-HD-NN-NG-NI-NS-NI-HD-NG O T-C-C-A-T-A-A-A-C-T OT-C-C-G-T-A-A-A-C-T O T-C-C-A-T-A-G-A-C-T OT-G-G-A-T-A-T-C-T-A T-C-C-G-T-A-C-A-C-T O T-C-G-C-T-A-C-C-T-Aarrow_forwardproteins can interact with DNA through relatively weak forces, such as hydrogen bonds and can der Waals interaction, as well as through stronger electrostatic interactions such as ion pairs. Which types of interaction predominate for sequence specifics DNA binding proteins and for sequence independent binding proteins?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
Genome Annotation, Sequence Conventions and Reading Frames; Author: Loren Launen;https://www.youtube.com/watch?v=MWvYgGyqVys;License: Standard Youtube License