Genetics: Analysis and Principles
6th Edition
ISBN: 9781259616020
Author: Robert J. Brooker Professor Dr.
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 20, Problem 21CONQ
Summary Introduction
To review:
Transposon elements (TE) to be the mutagen.
Introduction:
A chemical or physical agent that alters the genetic material of DNA (deoxyribonucleic acid), which in turn, decreases mutation frequency is called a mutagen. There are several mutations that result in cancer. Certain mutagens are carcinogens. Mutagens do not cause all the mutations. Some mutations are spontaneous which, are caused because of errors in replication of DNA, repair, hydrolysis, and recombination.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
You are working with a newly discovered mutagen, andyou wish to determine the base change that it introduces into DNA. Thus far, you have determined that themutagen chemically alters a single base in such a waythat its base-pairing properties are altered permanently.To determine the specificity of the alteration, you examine the amino acid changes that take place after mutagenesis. A sample of what you find is shown here:Original: Gln–His–Ile–Glu–LysMutant: Gln–His–Met–Glu–LysOriginal: Ala–Val–Asn–ArgMutant: Ala–Val–Ser–ArgOriginal: Arg–Ser–LeuMutant: Arg–Ser–Leu–Trp–Lys–Thr–PheWhat is the base-change specificity of the mutagen?
A certain compound that is an analog of the base cytosinecan become incorporated into DNA. It normally hydrogen bonds just as cytosine does, but it quite often isomerizes to a form that hydrogen bonds as thymine does. Doyou expect this compound to be mutagenic, and, if so,what types of changes might it induce at the DNA level?
Will the exon missense mutations be more likely to be transitions or transversions? Define both in
your explanation.
Chapter 20 Solutions
Genetics: Analysis and Principles
Ch. 20.1 - 1. Homologous recombination refers to the exchange...Ch. 20.1 - During the molecular process of homologous...Ch. 20.1 - 3. A key difference between the original Holliday...Ch. 20.1 - Which of the following mechanisms can cause gene...Ch. 20.2 - 1. During site-specific recombination that occurs...Ch. 20.2 - Prob. 2COMQCh. 20.3 - Which of the following types of transposable...Ch. 20.3 - Prob. 2COMQCh. 20.3 - Prob. 3COMQCh. 20 - 1. Describe the similarities and differences...
Ch. 20 - Prob. 2CONQCh. 20 - 3. Which steps in the double-strand break model...Ch. 20 - Prob. 4CONQCh. 20 - Prob. 5CONQCh. 20 - Prob. 6CONQCh. 20 - Prob. 7CONQCh. 20 - 8. What is gene conversion?
Ch. 20 - Make a list of the differences between the...Ch. 20 - Prob. 10CONQCh. 20 - Prob. 11CONQCh. 20 - 12. According to the double-strand break model,...Ch. 20 - What type of DNA structure is recognized by RecG...Ch. 20 - Briefly describe three ways that antibody...Ch. 20 - 15. Describe the functions of the RAG1 and RAG2...Ch. 20 - According to the scenario shown in Figure 20.7,...Ch. 20 - Prob. 17CONQCh. 20 - Prob. 18CONQCh. 20 - 19. Why does transposition always produce direct...Ch. 20 - 20. Which types of TEs have the greatest potential...Ch. 20 - Prob. 21CONQCh. 20 - 22. Let’s suppose that a species of mosquito has...Ch. 20 - This chapter describes different types of TEs,...Ch. 20 - Prob. 24CONQCh. 20 - Prob. 25CONQCh. 20 - 26. What is the difference between an autonomous...Ch. 20 - 1. Briefly explain how McClintock determined that...Ch. 20 - The work of McClintock showed that the presence of...Ch. 20 - 3. In your own words, explain the term transposon...Ch. 20 - Prob. 4EQCh. 20 - 5. Gerald Rubin and Allan Spradling devised a...Ch. 20 - Make a list of the similarities and differences...Ch. 20 - Prob. 2QSDCCh. 20 - Prob. 3QSDC
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- What percentage of the DNA in the genome actually corresponds to genes? How much is actually protein-coding exons? What makes up the rest?arrow_forwardYou are working with a newly discovered mutagen, and you wish to determine the base change that it introduces into DNA. Thus far, you have determined that the mutagen chemically alters a single base in such a way that its base-pairing properties are altered permanently. To determine the specificity of the alteration, you examine the amino acid changes that take place after mutagenesis. A sample of what you find is shown here:Original: Gln–His–Ile–Glu–LysMutant: Gln–His–Met–Glu–LysOriginal: Ala–Val–Asn–ArgMutant: Ala–Val–Ser–ArgOriginal: Arg–Ser–LeuMutant: Arg–Ser–Leu–Trp–Lys–Thr–Phearrow_forwardBelow are several DNA sequences that are mutated compared with the wild-type sequence. Eachis a section of a DNA molecule that has separated in preparation for transcription, so you are onlyseeing the template strand. For each mutated DNA sequence, translate and record the resultingamino acid sequence. What type of mutation is each? Wild-type sequence: 3’-T A C T G A C T G A C G A T C-5’ Mutated DNA Template Strand #1: 3’-T A C T G T C T G A C G A T C-5’Amino acid sequence of peptide:Type of mutation: Mutated DNA Template Strand #2: 3’-T A C G G A C T G A C G A T C-5’Amino acid sequence of peptide:Type of mutation: Mutated DNA Template Strand #3: 3’-T A C T G A C T G A C T A T C-5’Amino acid sequence of peptide:Type of mutation: Mutated DNA Template Strand #4: 3’-T A C G A C T G A C T A T C-5’Amino acid sequence of peptide:Type of mutation:arrow_forward
- Can a harmful mutation-causing genetic disease exist from generation to generation without exhibiting the symptoms of the disease? Explain.arrow_forwardHow is paramutation similar to normal gene mutation? How does it differ? Make a list of similarities and differences.arrow_forwardWhat is a mutagen? Name two common mutagens andtheir effects on DNAarrow_forward
- Below is a sample of a segment of DNA…(copy from left to right) 3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’ 5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’ 1.Assume the 6th amino acid is changed from T to G on the DNA template strand. What type of mutation is this? What effect would this have on the protein? Look up an example for this type of mutation. 2, Assume the 5th and 6th amino acids are removed from the DNA template strand. What type of mutation is this? How would this affect the protein? Look up an example of this type of mutation. 3.Which mutation changes the protein more...a point mutation or a frameshift mutation. Explain your reasoning. 4.What would be the problem if ATT was inserted into the DNA template strand after the second codon? (Be sure to consult the coding chart for amino acids). 5. What if the second amino acid was repeated over 5Ox. What amino acid is repeated? What type of mutation is this? If this is on chromosome 4, what genetic disorder is this?…arrow_forwardWhat proportion of exons are repeated sequences in the human genome? Is 38% surprising?arrow_forwardIs homologous recombination an example of mutation? Explain.arrow_forward
- In the table below, there are four versions of gene A, one of which is normal, and the other three which contain mutations that make the gene product nonfunctional. Focus on the shaded region of the sequence. Use the genetic code table to answer the question. How would you describe Mutation #2? Partial DNA sequence for gene A ("..." indicates many nucleotides of sequence not shown) 5' ... ATG GTG AGC AAG GAG GAG CTG TTC ACC TGT AAA TAG ... Normal Mutation #1 5' ... ATG GTG AGC AAG GAG AAG CTG TTC ACC TGT AAA TAG ... Mutation #2 5' ... ATG GTG AGC AAG TAG GAG CTG TTC ACC TGT AAA TAG ... Mutation #3 5' ... ATG GTG AGC AAG GAG CTG TTC ACC TGT AAA TAG ... Silent mutation Nonsense mutation Frameshift mutations Missense mútationarrow_forwardDescribe the difference between Sanger based sequencing and Next Generation Sequencing (NGS). Why is NGS advantageous over Sanger based sequencing?arrow_forwardIn genetic transformation, what is meant by the wordcompetence?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- BiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage LearningHuman Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY