AKS 5c1: The model below shows the process of protein synthesis. What is the best explanation for what occurs during process A and process B? * IA AMQAAQUUU IB methionine phenyl alanine lysine leucine alanine glycine Process A is showing transcription, which uses a DNA template to create an mRNA copy of the genetic code. Process B is showing translation, which uses the MRNA to create a polypeptide chain. Process A is showing translation, which uses a DNA template to create an MRNA copy of the genetic code. Process B is showing transcription, which uses the MRNA to create a polypeptide chain. Process A is showing transcription, which uses the MRNA to create a polypeptide chain. Process B is showing translation, which uses a DNA template to create an MRNA copy of the genetic code. Process A is showing translation, which uses the mRNA to create a polypeptide chain. Process B is showing transcription, which uses a DNA template to create an mRNA copy of the genetic code OF OF

AKS 5c1: The model below shows the process of protein synthesis. What is the best explanation for what occurs during process A and process B? * IA AMQAAQUUU IB methionine phenyl alanine lysine leucine alanine glycine Process A is showing transcription, which uses a DNA template to create an mRNA copy of the genetic code. Process B is showing translation, which uses the MRNA to create a polypeptide chain. Process A is showing translation, which uses a DNA template to create an MRNA copy of the genetic code. Process B is showing transcription, which uses the MRNA to create a polypeptide chain. Process A is showing transcription, which uses the MRNA to create a polypeptide chain. Process B is showing translation, which uses a DNA template to create an MRNA copy of the genetic code. Process A is showing translation, which uses the mRNA to create a polypeptide chain. Process B is showing transcription, which uses a DNA template to create an mRNA copy of the genetic code OF OF

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter30: Protein Synthesis

Section: Chapter Questions

Problem 2P

See similar textbooks

Similar questions

10. A portion of 5'-AUGCCACGAGUUGAC-3'. What amino acid sequence does this code for? To answer the question please: I) explain what is the genetic code and list the properties of the genetic e 2) draw a diagram of protein synthesis; 3) determine which tRNA should be attached to the mRNA; 4) what is the anticodon for the very first tRNA that will attach to mRNA? mRNA molecule has the sequence an
Original sequence: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a translational start): 5’-GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3’ Question: 4) In a mutant you discovered that the underlined nucleotide has been deleted. What would the resulting peptide sequence be? What type of mutation is this? 5’-GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3
a. Use the genetic code provided in class to predict the sequence of protein formed from the following RNA strand. CGCUACAUCUUU b. If a gene mutation results in a frame shift, meaning the RNA sequence being read shifts rover by a base, and the translation machinery codes, instead, using the nucleotide sequence below, what is the amino acid sequence in the resulting portion of protein? GCUACAUCUUUA c. If a gene mutation results in a point mutation, meaning a single nucleotide is converted to a different nucleotide base, and the translation machinery codes, instead, using the nucleotide sequence below, what is the amino acid sequence in the resulting portion of protein? CGCUCCAUCUUU d. Which mutation is more likely to result in a slightly altered, but still functional, protein, the frame shift mutation or the point mutation? Briefly explain your answer.
Date: Class: Name: RNA Modification Questions Answer the following questions. 1. What is the initial transcript called? 2. What is the final messenger MRNA called? 3. What two things are added to the messenger RNA? 4. What fragments are removed from the messenger RNA? 5. Why are the poly A tail and methyl G cap important? 6. Below, on the left, are the sequences of 3 pre-mRNAs. The exons are underlined and the introns are not underlined. Draw the mature mRNA's (ready to leave the nucleus) below each pre-mRNA. a. AUGGGGCCCAAACCCCAGUUUUAA b. AUGCAGUUGUUACGCCAAGGCCCGCGCGAUAG c. AUGUCAUGUAUCAUGUAUGUAUGUAUGUAUGUAGUAUGUAGUAUGUUUGUAUAAA (C) 2015 Bethany Lau.
You continue to study the expression of the hexose kinase gene and capture the following electron micrograph of the gene being expressed. MRNA 1 20 ORI 40 60 TTCGAGCTCTCGTCGTCGAGATACGCGATGATATTACTGGIAATATĞGGGATGCACTATC 5' 3' AAGCTCGAGAGCAGCAGCTCTATGCGCTACTATAATGACCA'NTATAÇCCCTACGTGATAG CACTATC promoter RNA polymerase ribosome
AKS 5c1: Which explanation accurately describes the model below? * DNA MRNA Transcription Mature MRNA Nucleus Transport to cytoplasm for protein synthesis (ranstation MANA Cell membrane This model represents protein synthesis since the tRNA is delivering amino acids to form a polypeptide chain that will form a protein. This model represents protein synthesis since the tRNA is delivering lipids which will be used to bond proteins to form an enzyme. This model represents protein synthesis because DNA is being copied during transcription in the nucleus before leaving the nucleus. This model represents protein synthesis because MRNA is coiling to form a new protein molecule in the cytoplasm.
a. Describe the different stages that occur during the translationprocess of Protein Synthesis.(b) using four examples of antibiotic inhibitors of translation, outlinehow inhibition occurs.
Describe translation. What is the function of the aminoacyl-tRNA synthase?
4a) Write out the protein sequence (the amino acids, in order) encoded by the mRNA sequence: 5'AUGCGACCUAGCUAUGGA3'
Name: Clas: Date: Transcription 3" ATGACGGATCAGCCGCAAGOCGGAAfTGGCGACATAA UACUGCCUAGUCGGCGUU 3 5' WA WAW TACTGCCTAGTCGGCG TCGCCTTAACCGCTGTATT 3' 6 Label the diagram as you read the following passage. Transcription is the process cells use to copy information from DNA into messenger RNA copies. Part of the chromosome's tightly wound-up long strand of DNA is "loosened" to allow for RNA polymerase room to copy part of the DNA. Think of this as opening a page out of a giant book with thousands of pages to make a copy of just that one page. One side of the DNA strand is the template strand (or anti-sense strand) and is used by an enzyme called RNA Polymerase to create the messenger RNA. RNA Polymerase is directed by a bunch of proteins called transcription factors to the spot it needs to start copying. RNA Polymerase reads the template strand from the 3' end to the 5' end and creates a messenger RNA strand that is complementary to the template strand. In the diagram above, you can see that…
Molecular Biology (Biol-L211) Dr. Nole Central Dogma Practice - Processes The general flow of genetic information is diagrammed below. Think carefully about what type of molecule is represented by each item in the diagram and clearly address each of the following. A. Label each structure as mature mRNA, pre-mRNA, protein, or DNA. B. Label each arrow to indicate which is processing, transcription, replication, and translation. C. Identify the general location (on the appropriate molecule) of the promoter sequence and the terminator sequence. D. Identify the specific location of the place where the start codon and stop codon function most directly (i.e., which molecule is actually translated?). E. Where does RNA polymerase bind to begin transcription? F. Where specifically does the ribosome bind to begin translation-i.e., what are the ribosome binding sites (in both prokaryotes and eukaryotes) and where are they found? G. Label each end of the mature mRNA and the polypeptide to correctly…
Molecular Biology (Biol-L211) Dr. Nole Central Dogma Practice - Processes The general flow of genetic information is diagrammed below. Think carefully about what type of molecule is represented by each item in the diagram and clearly address each of the following. A. Label each structure as mature mRNA, pre-mRNA, protein, or DNA. B. Label each arrow to indicate which is processing, transcription, replication, and translation. C. Identify the general location (on the appropriate molecule) of the promoter sequence and the terminator sequence. D. Identify the specific location of the place where the start codon and stop codon function most directly. E. Where does RNA polymerase bind to begin transcription? F. Where specifically does the ribosome bind to begin translation-i.e., what are the ribosome binding sites and where are they found? G. Label each end of the mature mRNA and the polypeptide to correctly specify polarity. (You should use the labels 3', 5', C-terminus, and N-terminus.)