What is the sequence of the peptide that would result following translation with a ribosome? Write your answer like this Met Ala Gly...... 2. What mutation(s) would change the peptide to Met Asp Asn Gly Leu Gly ? Use the codon numbers to help describe where the mutation is located
Q: if the heterozygous phenotype is intermediate between that of the homozygotes, this is called Multip...
A: According to Mendel's law of dominance, in heterozygous condition, the phenotype of only one of the ...
Q: What is the conceptual connection between Figures 12-12 and 12-19?
A: 12-12: Regulatory sequences are revealed by chromatin remodelling (When SWI-SNF is attracted to a sp...
Q: In ONE sentence define the function of the following 1. SSBS = The SSBS are single 2. Beta subunit o...
A: These are all the enzymes used in replication of DNA Replication of DNA is a very important process ...
Q: What is the function of IFT?
A: IFT stands for Inter Ferential Therapy. It was discovered in the early's 1950. It is a very popular ...
Q: Shown below is the genomic structure of the wild-type gene for the human gene transthyretin. The num...
A: Introduction: A nucleotide is an organic molecule that is the building block of DNA and RNA. They al...
Q: ]Let's Apply Directions: Determine what concept of speciation and evolution is being described in ea...
A: Introduction Evolution is the change in the characteristics of a species over several generations an...
Q: The inheritance pattern of a rare form of Xeroderma pigmentosum is exhibited in the pedigree shown b...
A: Foundation Xeroderma pigmentosum (XP) is a rare autosomal recessive (passive) disorder portrayed by ...
Q: Spondylocostal dysostosis is an autosomal recessive disorder with characteristics including short th...
A: Introduction : Hardy Weinberg principle states that the allele frequencies in a population are stabl...
Q: How does Salmonella typhimurium avoid being killed by phagocytes.
A: Salmonella manipulates inflammatory pathways and the autophagy process. Salmonella evades the adapt...
Q: Below is a simple set of weights obtained while immersing potato slices in various sugar solutions o...
A: Note: As per Bartleby Guidelines For Remaining Answers Please Repost The Question. Introduction: Suc...
Q: Explain the relationship among red algae, green algae,and land plants
A:
Q: Describe each of the surface modification of epithelial cells. in terms of: structure, location and ...
A: Answer :: Surface modification of epithelial cells Apical surface structure,location and functions. ...
Q: In rabbits, black hair depends on a dominant allele, B, and brown hair on a recessive allele, b. sho...
A: The alleles are the alternative forms of a gene that are located on the same locus of a homologous c...
Q: Does a negative change in the oxygen per minute indicate photosynthesis or cellular respiration?
A: Introduction The process by which plants use sunlight, water, and carbon dioxide to create oxygen an...
Q: 1. Explain the formation of exocrine and endocrine glands. 2. Differentiate exocrine and endocrine g...
A: as per our company guidelines we are supposed to answer only first question. Kindly repost other que...
Q: deu suoi op MOH
A: Q 1. DNA is the main genetic material, it is made up of polynucleotide. Mutation can be defined as...
Q: Severe weather events can create ecological disturbances, which can impact biodiversity. Think about...
A: The severe weather event can create a number of ecological disturbances, such as changes in temperat...
Q: Describe the arrangement of floral members in relation to their insertion on the thalamus. Calyx, co...
A: In angioSperms, the reproductive unit is represented by the flower. It is intended for the purpose o...
Q: chin fissure is a dominant trait controlled by a single gene. If a man (homozygous dominant) with ch...
A: As given chin fissure is a dominant trait which means it will express even if there is a single copy...
Q: Retrotransposons are mediated by the enzyme O a. transposase O b. RISC O c retrotransposase O d. ret...
A: Retrotransposons move by a copy and paste mechanism. However transportions describe the copy is made...
Q: Diatoms produce_________ that help(s) them float. a. phycobilins c. diatomaceous earth b. oils d. al...
A: A diatom is a single-celled photosynthetic organism, which means it produces its own food in the sam...
Q: What is Hybridization/Annealing ?
A: Annealing which is also known as Hybridization is defined as the spontaneous pairing occur of comple...
Q: In humans, maturing oocytes progress to metaphase of meiosis Il and then arres their development unt...
A: Oocyte is female germ cell or gametocyte which is involved in reproduction.Metaphase II in meosis th...
Q: What are the disadvantages of double fertilization in angiosperms
A: Angiosperms are a type of plants which have flowers and have seeds inside a fruit and have the large...
Q: Archegonia 50 um
A: 1. young archegonium; 2. egg cell; 3. neck canal cells; 4. mature archegonium; 5. neck canal; 6. mat...
Q: Do a punnet square to find the possible genotypes and phenotypes of the F1 generation when a plant t...
A: Parents - (a) homozygous for recessive pod color and heterozygous for pea shape - ggRr (b) heterozyg...
Q: You are a mad scientist tasked with the evil job of designing a novel species. This species will be ...
A: The characteristics of this species can be as follows: - Infective in nature, involving either gast...
Q: When a population reaches a stable age distribution all age classes have the same mortality rate th...
A: Answer;- older individuals outnumber younger individuals Explain;- The thought of stable age distrib...
Q: 13.14. On the following figures, genes A and B are on the X chromosome (bluel and both are subject t...
A: Introduction: Electrophoresis is defined as a technique of separation of the charged molecules of th...
Q: F1 Phenotype of the Testcross phenotypic Phenotypic ratio in the F2 phenotype tester ratio 12/16 cre...
A: Test cross is a test to find out the the genotype of a dominant phenotype. So it is the cross betwee...
Q: In your own understanding, explain the storage and mobilization of lipids.
A: A lipid is a macro biomolecule which is soluble in non - polar solvents in biology and biochemistry....
Q: Question 6. You are given two samples of DNA from two different organisms. In which of the following...
A: DNA can be found as a genetic material in most of the living creatures. This is because thew DNA act...
Q: A house is launched into space, wearing a suit that provides it with oxygen but very little insulati...
A: Overview Hypothermia is a medical emergency that occurs when your body loses heat faster than it can...
Q: Why do you think RNA cannot serve as the genetic material of most living organisms? 2. What do you t...
A: DNA is the main genetic material which is present in the nucleus of a cell. It transcribe RNA with ...
Q: Define and describe prions, including their replication process and contrast them with viruses.
A: A prion is a type of protein that can trigger normal proteins in the brain to fold abnormally. Prion...
Q: Sex-linked trait and Sex-influenced trait (Lesson 7) 1. Hemophilia is a disease inherited as a X-lin...
A: Hemophilia is X linked recessive disorder in which disease causing allele is present on the X chromo...
Q: Describe how PCR is used to amplify a specific gene from total cellular DNA.
A: The process of amplifying a specific DNA sequence containing a gene of interest is known as polymera...
Q: Disease occurred-How did the population growth curve with many predators compare the normal populati...
A: An ecosystem is a natural community of living beings that deals with the external environment and ot...
Q: Female cottontail rabbits (sylvilagus floridanus) are especially fertile, able to give birth to seve...
A: Cutoff points to Growth A female cottontail bunny (Sylvilagus floridanus) can conceive an offsprin...
Q: . Let’s say that you have incredible skill and can isolate the white and red patches of tissue from ...
A: Mutation It can occur due to errors in DNA copying during cell division, ionising radiation exposur...
Q: List the steps of how the sodium-potassium ATPase pump works
A: Sodium-potassium ATPase pumps the ions using active transport, that is against the concentration gra...
Q: In drosophila embryos that are null mutants for hedgehog (hh'/hh), expression of which of the follow...
A: In drosophila, segment polarity genes are those genes which act to specify the correct pattern of st...
Q: During splicing, what molecular component of the spliceosome catalyzes the cutting out of the lariat...
A: Splicing: Splicing is the process in which the introns and the noncoding part of the genes are excis...
Q: Cystic fibrosis (CF) is an autosomal recessive disorder. Several different individual point mutation...
A: Cystic Fibrosis - An hereditary disease that affects the lungs and digestive system and can be fatal...
Q: The following figure shows how the activities (y-axis) of Cdk-Cyclin B complex and the APC complex c...
A: * Mitosis is type of cell division where cell divides into two which gives genetically identical cel...
Q: Answer 19,20,21,22 whether true or fale for each number 19.Wear dust-mask or cover your face with c...
A: The goal of island biogeography is to study the climatic conditions which affect the flora and fauna...
Q: In humans, gene A is paternally imprinted. The paternal copy of the gene is methylated and not expre...
A: Given Family 1 Father's gene is not expressed in both dominant as well as in recessive condition. ...
Q: In one, simple sentence define the function of the following 1. Helicase = 2. Alpha subunit of D...
A: DNA helicases are essential during DNA replication because they separate double-stranded DNA into si...
Q: 1. Decoding mRNA into amino acids is called translation.
A: above given statements are about transcription, translation process and how amino acids makes a prot...
Q: You isolated a gene expressed in differentiated neurons in mice. You then fused various fragments of...
A: ANSWER;- The Promoter is a little DNA (deoxyribonucleic acid) arrangement of a gene, where the RNA (...
Proteins
We generally tend to think of proteins only from a dietary lens, as a component of what we eat. However, they are among the most important and abundant organic macromolecules in the human body, with diverse structures and functions. Every cell contains thousands and thousands of proteins, each with specific functions. Some help in the formation of cellular membrane or walls, some help the cell to move, others act as messages or signals and flow seamlessly from one cell to another, carrying information.
Protein Expression
The method by which living organisms synthesize proteins and further modify and regulate them is called protein expression. Protein expression plays a significant role in several types of research and is highly utilized in molecular biology, biochemistry, and protein research laboratories.
1. What is the sequence of the peptide that would result following translation with a ribosome?
Write your answer like this Met Ala Gly......
2. What mutation(s) would change the peptide to Met Asp Asn Gly Leu Gly ?
Use the codon numbers to help describe where the mutation is located
Step by step
Solved in 3 steps
- mRNA Codon Chart: Second letter с บบบ UCU UAU Phe UUC UCC U Ser UAC Tyr UGU UGC Cys UUA UCA Leu UAA Stop UGA Stop A UUG UCG UAG Stop UGG Trp CUU CCU CAU CGU CUC CCC His CAC Leu Pro CUA CCA CAA CGA Arg Gin CUG CCG CAG CGG AUU ACU AAU AUC lle ACC AAC AGU ]Asn Ser AGC A Thr AUA ACA AAA Lys AGA Arg AUG Met ACG AGG GUU GCU GAU GUC GCC Val GAC Asp GGU GGC Ala GUA GCA GUG GCG GAG GGG GAA Glu GGA Gly Amino Acid 3-Letter Codes Name of Amino Name of Amino 3-Letter Code 3-Letter Code Acid Acid Alanine Ala Leucine Leu Arginine Arg Lysine Lys Asparagine sex Methionine Met (start) Aspartic Acid Asp Phenylalanine ebe Cysteine Cve Proline Pro Glutamic Acid Glu Serine Ser Glutamine Gln Threonine Glycine GLK Tryptophan JAR Histidine His Tyrosine Tyr Isoleucine lle Valine Val Exercise: Transcription & Translation 1. Choose 3 DNA Templates. 2. Write the mRNA sequence divided into 3 letter codons. 3. Write the sequence of amino acids. 4. Find the corresponding amino acid sequence and include the letter of…ule_2023_Spring_Stu x M Inbox (1) - Ic21-0506@lclari X =6104_EP#6 - Google Docs ent/d/104sNODGApfrUg768nDS9piPmOB-VzXs86b_t-tDcDF8/edit My Drive - Google... WebAdvisor Main... ols Extensions Zotero Help text T Arial Haplontic life cycle Diplontic life cycle Parthenogenesis Karyotype Histone - 11 + 2 4. Match the words with the correct definitions: | Alternation of generations Job Listing - USF... WT Enrollment Requir... B I U 3 4 X 0 Lecture Video: The Cell Cyc x Chemical Principl... UO UND Orn Z = - 1:3 A type of reproduction that produces a clone of the mother A protein DNA wraps around it to condense the DNA An organism alternates between 1n and 2n with each generation A complete set of chromosomes, as they appear in the nucleus When an organism spends most of its life in the 1n state When an organism spends most of its life in the 2n state 11personal/eenongen_my_tnstate_edu/_layouts/15/doc.aspx?sourcedoc={a6b083c9-a226-4c31... O Search (Option + Q) Review View Help Editing v A BI U Ov =<=v 三 v ... Question 13 Zinc finger nuclease is a Gene editing tool: which uses a site-specific endonucleases containing a DNA-cleavage domain and a modular DNA-binding domain RNA-guided endonucleases programmable nucleases Exonuclease Question 14 Which elements are required for DNA to behave as a chromosome in yeast cells: a centromere an autonomous replicating sequence two telomeres Antibiotic selection marker Question 15 A series of such clones where the insert of each clone partially overlaps that of its neighbors with no gaps is known as a Clone Contig DNA fingerprinting A tiling path Genome MacBook Pro
- 5’ AAACUGUGACUGAACCUCAAACCCCAAACCAGCCCGAGGAGAACCACAUUCUCCCAGGGA CCCAGGGCGGGCCGUGACCCCUGCGGCGGAGAAGCCUUGGAUAUUUCCACUUCAGAAGCC Find start codon and stop codon UACUGGGGAAGGCUGAGGGGUCCCAGCUCCCCACGCUGGCUGCUGUGCAGAUGCUGGACG ACAGAGCCAGGAGGGAGGCCGCCAAGAAGGAGAAGGUAGAGCAGAUCCUGGCAGAGUUCCAGC UGCAGGAGGAGGACCUGAAGAAGGUGAUGAGACGGAUGCAGAAGGAGAUGGACCGCGGCCUGA GGUAGAAGCCGCUGGGGCUUGGGGCU-3’Kindly help, I don't understand this topic :(( In each of the following DNA sequences, write the contesponding mRNA transcript right beside the item we the item and use the genetic code to determine the resulting amino acid sequence. You may proceed even without the start codon 1. TTTTACCATCCCACAATTTA 2 ACTACTTTCAGAGCTATATTCAG 3. CATTACGGAGCCTGATGCACTTAC 4. TACGCCGCAACTCCGTATGGO 5. Garg-CTACAGCCCTAGCATTTACCCGREAD INSTRUCTIONS WND COMPLETE MRNA CODON COLUMN
- Original DNA DNA Protein TACGCTATGAGC Methionine-Arginine-Tyrosine-Serine Mutation #1 DNA What type of mutation occurred? substitution insertion duplication deletion TACTCTATGAGCQ3. Cystic fibrosis is an autosomal recessive inherited disorder that causes severe damage to the lungs, digestive system and other organs in the body. Cystic fibrosis affects the cells that produce mucus, sweat and digestive juices. The disease occurs when there is a mutation in the cystic fibrosis transmembrane conductance regulator (CFTR) gene, which is the gene responsible for the movements of negatively charged particles known as chloride ions into and out of cells. Using the base pairing rules and the codon table, determine the mRNA and protein sequences produced by the CFTR gene's segment (below). Transeription begins at and includes the bold and underlined G nucleotide. CFTR gene's segment. - GCGATGTACAACCGAGGGTAAAAAA - 3' coding sequence a) The DNA template sequence 3'.. ...5' b) Fill in the first 9 nucleotides of the primary/ nascent mRNA transcribed from Gene A. 5'-.... -3' c) Protein N-term... . . C- terminus d) Exposure to cigarette smoke (a known mutagen) deletes base #9…Mutated DNA Sequence #2 T A C G A C C T T G G C G A C G A C T … What’s the mRNA sequence? (Circle the change) What will be the amino acid sequence? Will there likely be effects? What type of mutation is this? ________________________________
- position position (5' end) position (3' end) UUU Phe - F UUC Phe UAU Tyr Y. UAC Tyr UAA Stop UGU Cys UGC Cys UGA Stop UGG Trp UCU Ser UCC Ser U UUA Leu UUG Leu UCA Ser UCG Ser UAG Stop W 輔 CAU His CGU Arg CGC Arg CGA Arg CGG Arg CUU Leu CCU Pro CUC Leu CCC Pro P. CCA Pro CÁC His CỦA Leu CAA Gln CUG Leu CCG Pro CAG GIn AUU lle ACU Thr AAU Asn AGU Ser AUC lle ACC Thr -T ACA Thr AAC Asn_ AGC Ser AGA Arg AGG Arg A AUA lle AAA Lys EK AAG Lys AUG Met ACG Thr GUU Val GGU Gly GGC Gly GGA Gly GGG Gly GAU Asp D GAC Asp GCU Ala GUC Val -V GUA Val GCC Ala GCA Ala GCG Ala G - A GAA Glu FE GAG Glu GUG Val Nonpolar Polar Basic Acidic Stop codon Table 4.1 Biology: How Life Works, Third Edition © 2019 W. H. Freeman and Company Consider the DNA sequence–3'-CACTGGTAGCGA–5', • What is the sequence of the messenger RNA sequence that is transcribed from this DNA sequence? (Indicate the 5' and 3' ends of the RNA molecule.) • Consult the genetic code that is shown above. What is the amino acid sequence of the…oseg 1su Third Base ne following questions refer to Figure 17.2, a table of codons. Second Base nnn UUC UAU non Tyr UCC UAC UGA Stop dois UGG UUA JOS UCA UAA ne UUG UCG UAG di dois CCU CAU CGU CUC SIH CGC CCC CAC CUA no7 CGA CCA Old CAA CCG CAG CGG AAU AUC JOS USV AGC ACC AAC AUA ACA AAA AGA AUG Met or Start Lys ACG AAG GCU GAU dsy GGC GUC GCC GAC Ala Gly GUA GCA GAA GGA GUG GCG GAG GGG Figure 17.2 A peptide has the sequence NH2-phe-pro-lys-pro-gly-phe-pro-COOH. Which Of the following sequences in the coding strand Of the DNA could equal the code for this peptide? a. 5' GGG-AAA-TTT-AAA-CCC-ACT-GGG b. 5' TTT-CCC-AAA-CCC-GGG-TTT-CC c. 3' AUG-AAA-GGG-TTT-CCC-AAA-GGG d. 3' UUU-CCC-AAA-GGG-UUU-CCC e. 5' TTT-CCC-AAA-GGG-TTT-CCCPlease answer fast A. Below is a small 2 exon long gene. The exons are underlined, and the 22 nucleotide long intron is the non-underlined sequence between the exons. TAG, TAA, and TGA are stop codons. 5’-TAGTGTATTGACATGATAGAAGCACTCACTATATTCTGACGTGCGACTATGCGTGGGGTTAGGT ATTGTGCTGACTTTTCTCAGGTGGCCCGTATAGGCTAAGCTGCGCATCGCCGCTAGTCGCTCAGTTCCGC TGGCGGCATTTTAACTTTCTTTAATGAATGCGGGCATATTTAATACGCGCTATGCGCATCGTATGCGAT-3’ 1) What are the first five deoxyribonucleotides of the DNA template strand read by RNA polymerase in the 3’ to 5’ direction? 3'-____ -5' 2) What are the first five ribonucleotides of the mRNA transcript of this gene ? 5'-____-3' 3) What are the first five ribonucleotides following exon 1 in the mature mRNA transcript? 5'-_____-3' 4) What is the 5' UTR of the mature mRNA transcript in ribonucleotides? 5'-_____-3' 5A) What are the first five ribonucleotides of the 3' UTR? 5'-_____-3' B) What are the last five ribonucleotides of the 3' UTR? 5'-______-3' 6) How many amino acids are…