Microbiology: A Systems Approach
5th Edition
ISBN: 9781259706615
Author: Marjorie Kelly Cowan Professor
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 10, Problem 1CM
Using the words that follow, please create a concept map illustrating the relationships among these key terms from chapter 10.
DNA
restriction endonuclease
palindrome
ligase
plasmid
vector
origin of replication
recombinant
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
Define/Compare/Contrast/Distinguish these three terms:
F plasmid
F’ plasmid (and how is it formed)
Hfr cell (and how is it formed)
Second part asks: Explain the roles two of those enzymes would play in obtaining the recombinant plasmids
The image shows a replication fork with template DNA strands, new DNA strands, and some replication proteins. Label the
mage by moving the terms or descriptive phrases to the appropriate targets.
lagging strand (or Okazaki fragment)
Answer Bank
protein that synthesizes RNA primer
DnaB helicase
DNA gyrase (topoisomerase)
Chapter 10 Solutions
Microbiology: A Systems Approach
Ch. 10.1 - Provide examples of practical applications of...Ch. 10.2 - Prob. 2AYPCh. 10.2 - Describe how gel electrophoresis is used to...Ch. 10.2 - Prob. 4AYPCh. 10.2 - Prob. 5AYPCh. 10.3 - Prob. 6AYPCh. 10.3 - List examples of genetically modified bacteria,...Ch. 10.4 - Prob. 8AYPCh. 10.4 - Prob. 9AYPCh. 10.5 - Outline in general terms the process of DNA...
Ch. 10.5 - Prob. 11AYPCh. 10.5 - Prob. 12AYPCh. 10.5 - Prob. 13AYPCh. 10.6 - Prob. 14AYPCh. 10 - Which of the following is/are not essential to...Ch. 10 - Prob. 2MCQCh. 10 - The function of ligase is to a. rejoin segments of...Ch. 10 - The creation of biological molecules entirely from...Ch. 10 - Which of the following sequences, when combined...Ch. 10 - A region of DNA in a plasmid that is recognized by...Ch. 10 - Prob. 7MCQCh. 10 - Which of the following is a primary participant in...Ch. 10 - Single nucleotide polymorphisms are found in a....Ch. 10 - Microarrays are used to monitor a. the rate of DNA...Ch. 10 - Prob. 11TFCh. 10 - A nucleic acid probe can be used to identify...Ch. 10 - Prob. 13TFCh. 10 - In order to detect recombinant cells, plasmids...Ch. 10 - Plasmids are the only vectors currently available...Ch. 10 - You are a public health official trying to...Ch. 10 - a.Construct a strand of complementary DNA (cDNA)...Ch. 10 - a.Explain whether or not DNA polymerase from a...Ch. 10 - a.Define the term RFLP. Explain how RFLPs are...Ch. 10 - Prob. 5CTQCh. 10 - From chapter 6, figure 6.19. What has happened to...Ch. 10 - Prob. 2VCCh. 10 - Using the words that follow, please create a...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Identify the various types of DNA repair mechanisms known to counteract the effects of UV radiation. Drag the terms on the left to the appropriate blanks on the right to complete the sentences. Reset Help SoS repair is dependent on a photon-activated enzyme that cleaves thymine dimers. excision repair is the process by which an endonuclease clips out UV-induced dimers, DNA photoreactivation repair polymerase III fills in the gap, and DNA ligase rejoins the phosphodiester backbone. recombinational repair uses the corresponding region on the umdamaged parental strand of the same polarity. is a process in E. coli that induces error-prone DNA replication in an effort to fill gaps by inserting random nucleotides.arrow_forwardDefine the following terms: Genome Bacteriophage λ DNA Plasmid Restriction Enzyme Standard Curve Plasmid Maparrow_forwardU have the plasmid pUC18/19, which is a circular plasmid that consists of 2686 bp. What would the number of and length of the fragments be if you cut the plasmid with the following restriction enzymes or combination of enzymes? Give a schematic representation of the digestions. PscI & GsuI ______________________________________________________________ ScaI, PdmI & BsaXI ______________________________________________________________ ScaI, SspI & EheI ______________________________________________________________arrow_forward
- Define the following terms: Bacteriophage λ DNA Plasmid Maparrow_forwardRemdesivir is an antiviral drug used to treat SARS-CoV-2 infections. It is a broad-spectrum antiviral, meaning it has activity against many different viruses. Remdesivir can be incorporated into a new RNA chain as a virus replicates and can interfere with the viral replication machinery. Template RNA Elongation New RNA SARS-CoV-2 RNA polymerase Template groove Nucleotide entrance Nucleotides Remdesivir Figure 1. A representation of remdesivir and the viral replication machinery for SARS-CoV-2. 6. Figure 1 shows that remdesivir "mimics” an important component of RNA replication. Which specific component of RNA replication has a structure like that of remdesivir? 7. Propose a hypothesis about how remdesivir might inhibit the virus's replication process.arrow_forwardThe following image will be used to answer questions 1 through 9. Below is a restriction map of the circular plasmid YIP5. This plasmid contains 5,541 base pairs. There is an EcoRI site at base pair 1. The locations of other restriction sites are shown on the map. The numbers after the enzyme names tell at which base pair that enzyme cleaves the DNA. If you digest YIP5 with any one of the listed restriction enzymes you will end up with a linearized piece of DNA that is 5,541 base pairs long. EcoRI 1/5541 HindIII 32 Pvul 4916 Eagl 942 YIP 5 Apal 2035 Pvull 3247 Smal 2540 Reaction B) You digest YIP5 with two enzymes, Hindll and Apal, at the same time. How many DNA fragments would you expect from this reaction and what are the sizes of the fragments?arrow_forward
- The following image will be used to answer questions 1 through 9. Below is a restriction map of the circular plasmid YIP5. This plasmid contains 5,541 base pairs. There is an EcoRI site at base pair 1. The locations of other restriction sites are shown on the map. The numbers after the enzyme names tell at which base pair that enzyme cleaves the DNA. If you digest YIP5 with any one of the listed restriction enzymes you will end up with a linearized piece of DNA that is 5,541 base pairs long. EcoRI 1/5541 HindIII 32 Pvul 4916. Eagl 942 YIP 5 Apal 2035 Pvull 3247 Smal 2540 Reaction A) You digest YIP5 with two enzymes, EcoRI and Eagl, at the same time. How many DNA fragments would you expect from this reaction and what are the sizes of the fragments?arrow_forwardpXO1 and pXO2 are large plasmids – large pieces of DNA that are not the chromosome that can replicate independently of the chromosome. What can a Bacillus anthracis cell with a pXO2 plasmid do that a cell without pXO2 can’t? I need help answering this quwhstion as short as possible based of what is said in the paperarrow_forwardIdentify a plasmid that is used to destroy its competitors. fertility plasmids bacteriocin plasmids virulence plasmids cryptic plasmids resistance plasmidsarrow_forward
- ________________ "cut" DNA at specific sequences and the resulting segment with sticky ends is "pasted" into a plasmid by ___________ to then be replicated in the host. Group of answer choices 1. Restriction enzymes; ethidium bromide 2 DNA polymerases; ligase 3 Restriction enzymes; ligase 4 Ligases; restriction enzymesarrow_forwardDiscuss two reasons you need to cut the plasmids prior to inserting them into the fertilized egg.arrow_forwardBelow is a portion of a bacterial chromosome that contains a gene. The promoter region and the +1 base pair are indicated, as well as the polarity of the two DNA strands. Analyse this DNA fragment and answer the questions 1-5 that follow. +1 -10 -35 3' TTGCATCCGAAACGTACGATCGATESGCCGACTTATTACGATCGGACTACTGCGTCGTAGC5' 5' AACGTAGGCTTTGCATGCTAGCTAGCCGGCTGAATAATGCTAGCCTGATCACGCAGCATCG3' ... ... Provide a brief statement in the space provided 1. What is the name if the TATTA sequence at -10 ? 2. What is the purpose of the -10 and -35 sites 3. What do you understand by the +1 site 4. Write the letters for the bases of the first 6 nucleotides of the mRNA molecule transcribed from this gene. Indicate the 5' and 3' end in your answerarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Bacterial Genomics and Metagenomics; Author: Quadram Institute;https://www.youtube.com/watch?v=_6IdVTAFXoU;License: Standard youtube license