A bag of Uncle John's potato chips contains 16 servings. What is the MAXIMUM amount of trans fat that could be in the bag of chips? 0.00 g 3.99 g 7.99 g 15.99 g
Q: Like other enzymes, arachidonic acid can be prevented from working by way of inhibitors. What…
A: Fatty acids are carboxylic acids with a hydrocarbon chain ranging from 4 carbon to 36 carbons. The…
Q: The Na,K-ATPase is a(n) [Select] [Select] and K+ from [Select] that moves Na+ from
A: When 2 species are transported in the same direction by a transporter, this type of transport is…
Q: In the Krebs cycle, the energy released by taking a compound off Coenzyme A is used to: Group of…
A: There are 2 two reactions in Krebs cycle were a compound is taken off Coenzyme A (CoA-SH). These two…
Q: An individual's blood sugar is low. Assuming normal regulatory patterns, are the following ratios…
A: If the blood glucose level is low, we need to reduce the rate of glycolysis as there is insufficient…
Q: Given the data in the table below and your knowledge of the "chemical standard state" (X) and the…
A: Chemical standard state is defined by standard conditions in chemical systems. These standard…
Q: 1. Scheme of aerobic oxidation of glucose and energy balance.
A: Aerobic oxidation of glucose is also called cellular respiration. Cellular respiration is a…
Q: 1) Perform the necessary calculations and fill in the values in the table below (be sure to include…
A: Enzymes are usually comprise of protein molecules which is used to catalyzed several biochemical…
Q: Using Haworth projections, draw the structure of an a-disaccharide of mannose B(1,2) galactose…
A: Carbohydrates or carbs are macronutrient consisting of Carbon, hydrogen and oxygen atoms. In nature…
Q: CH3C(double bond with O)COO- (aq) + H2O(l)⇌ Pyruvate, a product of glucose metabolism Express your…
A: Glycolysis is the collection of 10 enzymatically catalysed reactions that oxidises a 1 molecule of…
Q: Which enzyme in PPP creates glyceraldehyde 3 phosphate as a product? (Select all that apply)…
A: Pentose phosphate pathway (PPP) is an anabolic pathway that synthesizes pentose sugars and NADPH…
Q: Explain biochemical pathways mechanistically. Describe the β-oxidation pathway. Describe the…
A: Lipids are stored in the form of triacylglycerols in the body. When there are no carbohydrates in…
Q: Which of the following tests is used to differentiate between pancreatic insufficiency and…
A: Reduced nutrition absorption can be brought on by issues with mucosal transport or with intraluminal…
Q: in a specrophotometry ethanol determination experiment, you measured OD340 and assumed this…
A: Nicotinamide adenine dinucleotide: The molecules nicotinamide adenine dinucleotide (NAD) and…
Q: A certain metabolic pathway can be diagrammed as: X Y A B C D where A, B, C, and D are the metabolic…
A: Metabolism is the total of all chemical transformation that takes place in a living cell. One…
Q: name this reaction
A: The catabolic process of glycolysis is performed by almost every living cell. Glycolysis is the…
Q: How many calories are in 7101 J? (1 cal = 4.184 J)
A: Calories and joules are the units of energy . Energy is required by the body to perform functions.…
Q: 2. Another bodily process is the urea cycle. However, a carbamoyl phosphate is necessary to begin…
A: Carbamoyl phosphate is synthesized with the help of enzyme carbamoyl phosphate synthetase requiring…
Q: What are the greatest structural features that differentiate sphingolipids from phosphoglycerides?
A: Introducion Fatty acids are the important component of lipids. Lipid is one of the important…
Q: How does the degree of unsaturation and structure of fats affect its functionality, for example in…
A: Triglycerides or triacylglycerides or simple fats are fatty acid esters of glycerols. In…
Q: 4. Shown below is the structure of the anti-retroviral drug AZT. 5' HOCH, H 3 N₂ HN AZT H 12 H CH₂…
A: AZT is a drug that is used to treat HIV. HIV is a retro virus that causes the syndrome AIDS. When…
Q: The last residue of the protein (tail) is Tryptophan, and the first residue (head) is labeled with…
A: Fluorescence Resonance Energy Transfer (FRET) or simply RET is a technique used to calculate the…
Q: 2. The sequence of starting region of one DNA gene is shown: 5' GCATATGGCTTTTCCGCCGCGGCGACGGCTGCGC…
A: As per the central dogma of molecular biology, genetic information is stored in the DNA. The genetic…
Q: QUESTION 37 If glycogen synthase kinase-3 is active (check all that apply): O glycogen will not be…
A: Glycogen is a storage-type homopolysaccharide that contains two types of glucose polymers: amylose:…
Q: answer question 2 please asap
A: Polymerase chain reaction (PCR) can amplify a single target DNA fragment from a complex mixture of…
Q: What could be seen in the organic acid precipitation during the protein denaturation experiment if…
A: Proteins are large molecules made up of amino acid residues linked via a peptide bond. Amino Acids…
Q: 2. Draw the structure of the fatty acid, 16:247,10, as it occurs at pH 7. Make sure double bonds…
A: Fatty acids can be named and numbered in 2 ways. Fatty acids have a carboxylate end (COO- ) and a…
Q: RESULTS Table 1. Absorbance values of BSA standards. ● ● Test Tube No. BSA (μL) DDW (μL) 100 80 60…
A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…
Q: Phosphoenolpyruvate (PEP) is converted to pyruvate by the enzyme pyruvate kinase. The standard free…
A: The standard free energy change (∆Gº') is the amount of energy released in of biochemical reaction…
Q: Choose the statements that describe why the isomerization reaction is critical for the subsequent…
A: Glycolysis is the collection of 10 enzymatically catalysed reactions that sequentially oxidises a 1…
Q: What statement is true regarding LDL? Because the LDL is plasma lipoproteins with a lipid bilayer,…
A: Lipoproteins are triacylglycerols, phospholipids, cholesterol, and cholesterol esters associated…
Q: What is the isoelectric point of the following peptide molecule?…
A: The pH at which a specific molecule carries no net electrical charge is known as the isoelectric…
Q: -. Succinate dehydrogenase contains iron-sulfur centers in which irons are complexed with cysteine…
A: Succinate dehydrogenase have three 2Fe-2S centers. The 'Fe' here is complexed with the sulfur atom…
Q: Identify examples of a carbohydrate that is: unbranched, reducing monosaccharide
A: Chemically, carbohydrates are polyhydroxy aldehydes or ketones. They have the general formula :…
Q: In the following reaction, what quantity in moles of CH3OH are required to give off 4901 kJ of heat?…
A: The combustion of methanol (CH₃OH) is an exothermic reaction. During the process, the bonds such as…
Q: Imagine that you were asked to denature a protein; you know you can do so using urea. Your protein…
A: Denaturation is the process by which a protein looses it native structure, to the level that protein…
Q: All enzymes of the citric acid cycle are located in the mitochondrial matrix, except succinate…
A: Cellular respiration is the process how biochemical energy is generated from food. It involves the…
Q: 7. Specificity of membrane transporters. A protein that transports amino acids across the cell…
A: In competitive inhibition, the inhibitor competes with the substrate for binding at the active site…
Q: You are running a size exclusion column to purify your 25 kDa protein from a lysate mixture. The…
A: Size exclusion column chromatography: As a function of their respective sizes, molecules are…
Q: What would be the effect of a visualizing agent on the retention factor. Rf? A.Higher Rf B.Lower RF…
A: Visualising agent: The chemical agents that can be used to detect the number and location of the…
Q: Explain how an enzyme could distinguish between the (now circled) equivalent positions in the above…
A: Aconitase is an enzyme that catalyses the conversion of Citrate to isocitrate. Aconitase is an iron…
Q: Which of the following is 18:248,11?
A: Fatty acids can be named and numbered in 2 ways. Fatty acids have a carboxylate end (COO- ) and a…
Q: [Select] [Select] [Select] transport. V transport. would move across a membrane using simple…
A: The biological membrane that surrounds a living cell is called the cell membrane. The structure of…
Q: A new oxygen transport protein that exhibits cooperative binding has been isolated and is being…
A: Hemoglobin is an oligomeric protein with four polypeptide chains joined by non-covalent bonds. It is…
Q: Discuss three of the major steroids derived from cholesterol and their physiological role.
A: Lipids are a chemically diverse group with two common characteristics: low solubility in water and…
Q: 4. Amphiphilic Lipids. Detergents are small amphiphilic molecules that tend to form micelles in…
A: Ionic detergents contain anionic or cationic head group long with their hydrophobic tails being…
Q: I. Enzyme activity can be regulated by allosteric enzymes, feedback control, and covalent…
A: Since you have posted multiple questions, we will provide the solution only to the first five…
Q: Which of the following first messengers is a polypeptide? O acetylcholine adrenaline O insulin…
A: First messengers are biomolecules that bind to the cellular receptor to elicit a response within the…
Q: 3) An enzyme that converts a functional group to another between two structures, A) oxidoreductase…
A: Since you have posted multiple questions, we will provide the solution only to the first question as…
Q: The hormone interacts with the metabotropic receptor, as a result of further implementation of the…
A: The G protein is a protein found associated with G protein-coupled receptors. The receptor coupled…
Q: Discuss how each denatures protein.
A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- A slice of American cheese contains 7.34 g fat, 1.05 g carbohydrates, and 4.12 g protein. Calculate the number of nutritional calories (Cal) per serving in slice of cheese.A cheese-flavored snack cracker contains 10.0 g fat, 26.5 g carbohydrates, and 4.60 g protein per serving. Calculate the number of nutritional calories (Cal) per serving in this snack.The "Nutrition Facts" on a label of a 64 fluid ounce container of apple juice states that a serving size is 8 fluid ounces contains 128 Calories and 256 milligrams of potassium. Nutrition Facts Serving Size 8 fl. oz. (240mL) Servings Per Container: 8 Amount Per Serving Calories 128 % Daily Value* 0 % Total Fat Og Sodium 24mg 1 % Potassium 256mg 7 % Total Carbohydrate 29g 10 % Sugars 26g Protein Og a) How many calories would 1 fluid ounce of apple juice contain? b) How many milligrams of potassium would 1 fluid ounce of apple juice contain? Submit Question Jump to Answer
- How many grams of agarose do you need to make 25mL that is 2% agarose? 2% (w/v) = g/ 25mL 10 g O 2g O 0.5 g O 1gCarbohydrates provide 16.7 kJ per gram. If a person eats 200 g per day of digestible carbohydrates, what percentage of an 8350 kJ daily diet would be digestible carbohydrate?Does a food label that says “0 grams trans fat in one serving” mean that the food contains no trans fat? If not, how much trans fat could be in one serving of the food?
- What rate in mL/hr of Isosource VHN would provide 1.6 g protein/kg/day if run for 24 hours for a patient weighing 68 kg? Round to the nearest whole number, do not enter units EN Product Кcal Protein /mL g/L General Formulations Jevity 1.5 1.5 63.4 Isosource VHN 1 62 TwoCal HN 2 83 Renal Formulations Nepro 1.8 81 Renalcal 2 34.4 Supplena 1.8 45 Glucose Control Formulations Glucerna 1 41 Choice DM 1 45if you have Quinoa Serving size -170 grams Carbohydrates – 109 grams calculate the DV % for these values?Match the serving of food with the grams of carbohydrate Choose : 5,15,12,0 grams
- Pam Non-Stick Cooking Spray has a calorie count of 0 per serving on the Nutrition Facts label. The key components in Pam Non-Stick Cooking Spray are CANOLA OIL and SOY LECITHIN, according to the label. Explain When you discovered in Lab Exercise 9A that fats comprise 8.9 calories per gram, how can this be described as a "0 Calorie Food"?Each scoop of protein powder has 26 grams of protein. If you add 2 scoops of protein to your drink, how many kcals from the protein will you consume? Round to the nearest whole number. Include the unit in your answer after a space. (g for grams and kcals for calories). Conversion Chart Carbohydrates: 1 gram = 4 kcals Protein: 1 gram = 4 kcals Fat: 1 gram = 9 kcals Alcohol: 1gram = 7kcalsA liter of a TPN solution contains 500 milliliters of 50 percent dextrose solution and 500 milliliters of 5 percent amino acid solution. Determine the daily energy and protein intakes of a person who receives 2 liters per day of such a solution. Calculate the average daily energy intake if the person also receives 500 milliliters of a 20 percent fat emulsion three times a week.