Biology: The Dynamic Science (MindTap Course List)
4th Edition
ISBN: 9781305389892
Author: Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher: Cengage Learning
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Question
Chapter 14, Problem 16TYK
Summary Introduction
To review:
The fact that the evolutionary relationship of the amino acid sequences of the DNA polymerases found in Archaea show great similarity to Eukaryote but show little similarity to those of the DNA polymerases of bacteria.
Introduction:
DNA polymerases are the enzymes that carry out the process of
Expert Solution & Answer
Trending nowThis is a popular solution!
Students have asked these similar questions
Which of the following best explains the production of Okazaki fragments in replicating DNA
(a) DNA is stressed when it unwinds (b) DNA is anti-parallel and can only be synthesized 5’ to 3’ (c) DNA contains once less oxygen in its sugar while RNA has an OH attached to its 2’ carbon (d) Template strands are complementary and have a tendency to reform hydrogen bonds (e) both a and d
Which of the following statements most accurately describes the action of the enzyme RNA polymerase?Select one
1.) RNA polymerase will transcribe only the exons by skipping over the introns within a eukaryotic gene sequence
2.) RNA polymerase will transcribe both DNA strands, moving in the 3' to 5' direction for one strand and 5' to 3' on the other
3.) RNA polymerase will transcribe both DNA strands, but only one RNA molecule will be used during translation
4.)None of the statements accurately describe the function of RNA polymerase
Explain the statement "In a comparison between the DNAS of related organisms such as humans and mice, identifying the conserved DNA sequences facilitates the search for functionally important regions" is true or false.
Chapter 14 Solutions
Biology: The Dynamic Science (MindTap Course List)
Ch. 14.1 - Prob. 1SBCh. 14.2 - Prob. 1SBCh. 14.2 - Prob. 2SBCh. 14.2 - Prob. 3SBCh. 14.2 - Prob. 4SBCh. 14.3 - What is the importance of complementary base...Ch. 14.3 - Why is a primer needed for DNA replication? How is...Ch. 14.3 - DNA polymerase III and DNA polymerase I are used...Ch. 14.3 - Prob. 4SBCh. 14.4 - Why is a proofreading mechanism important for DNA...
Ch. 14 - Working on the Amazon River, a biologist isolated...Ch. 14 - Prob. 2TYKCh. 14 - Pyrimidines built from a single carbon ring are:...Ch. 14 - Which of the following statements about DNA...Ch. 14 - Which of the following statements about DNA is...Ch. 14 - Prob. 6TYKCh. 14 - Prob. 7TYKCh. 14 - Prob. 8TYKCh. 14 - Prob. 9TYKCh. 14 - Prob. 10TYKCh. 14 - Discuss Concepts Eukaryotic chromosomes can be...Ch. 14 - Prob. 12TYKCh. 14 - Prob. 13TYKCh. 14 - Discuss Concepts During replication, an error...Ch. 14 - Design an Experiment Design an experiment using...Ch. 14 - Prob. 16TYKCh. 14 - Prob. 1ITDCh. 14 - Prob. 2ITD
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- The technique of fluorescence in situ hybridization (FISH) is described. This is another method for examining sequence complexity within a genome. In this method, a DNA sequence, such as a particular gene sequence, can be detected within an intact chromosome by using a DNA probe that is complementary to the sequence.For example, let’s consider the β-globin gene, which isfound on human chromosome 11. A probe complementary to theβ-globin gene binds to that gene and shows up as a brightly colored spot on human chromosome 11. In this way, researchers can detectwhere the β-globin gene is located within a set of chromosomes. Becausethe β-globin gene is unique and because human cells are diploid(i.e., have two copies of each chromosome), a FISH experimentshows two bright spots per cell; the probe binds to each copy ofchromosome 11. What would you expect to see if you used thefollowing types of probes?A. A probe complementary to the Alu sequenceB. A probe complementary to a tandem array near…arrow_forwardA researcher sequences the genome of a variety of bacterial and eukaryotic cells. She finds that the bacterial genome is smaller, but that there are more genes for a given number of base pairs in the eukaryotic cells. In other words, there are fewer genes per unit of length of DNA in the eukaryotic cells. What do you predict she will find if she examines the DNA more closely? A. All of the bacterial DNA consists of coding sequences, but this is not true of the eukaryotic DNA. B. There are more repetitive sequences in the eukaryotic DNA than in the bacterial DNA. C. There are densely packed genes in the eukaryotic DNA that were not immediately distinguishable during the first analysis. D. The bacteria have larger quantities of noncoding DNA than the eukaryotic cells.arrow_forwardIn relation to central dogma of molecular biology answer the following questions: A- Give two reasons why the DNA replication is asymmetrical process (i.e. the DNA replication outcome is different between the leading and lagging strands)? B-The following segment of DNA is part of the transcription unit of a gene. You know already that RNA polymerase moves in a specific direction along this piece of DNA to convert one of the DNA strands into a single strand RNA transcript so that this entire region of DNA is made into RNA. 5′-GGCATGGCAATATTGTAGTA-3′ 3′-CCGTACCGTTATAACATCAT-5′ Given this information, a student claims that the RNA produced from this DNA is: 3′-GGCATGGCAATATTGTAGTA-5′ Give two reasons why this answer is incorrect. C- Imagine that the mRNA codons consisted of only two nucleotides instead of three nucleotides. Would there be a sufficient number of codons for all twenty amino acids? Explain your answer. D- The length of a particular gene in human DNA,…arrow_forward
- the one above: Replicate this sense strand to create a double-stranded DNA helix TGAGGATGAAACTCACACCGGGGCGCAGTTTGGCACTTAGATTCTTGTACACGACCTAGTATAACACAGTT Compare this mutated sense sequence given below to the original one given above and identify and classify all mutations that can be found in this new DNA sequence? TGAGCATGAAACTCACACCGGGGGCAGTTTCGCACTTAGGATTCTTGTACAGGACCTAGTATAACAAGTT 2. Using this mutated DNA strand, express it as a polypeptide by using the correct reading frame. When you get to the stop codon – you may write an “*” to denote the stop codon. 3. How many amino acids were changed in the mutated polypeptide?arrow_forwardPolymerase Chain Reaction (PCR) was invented by Kary Mullis in 1983. This technique had indeed facilitated research in various areas of molecular biology and genetics. Why is the annealing temperature vital in this technique? Explain how annealing temperature will affect the efficiency of this reaction.arrow_forwardDNA polymerases cannot act as primers for replication, yet primase and other RNA polymerases can. Some geneticists have speculated that the inability of DNA polymerase to prime replication is a result of its proofreading function. This hypothesis argues that proofreading is essential for the faithful transmission of genetic information and that because DNA polymerases have evolved the ability to proofread, they cannot prime DNA synthesis. Explain why proofreading and priming functions in the same enzyme might be incompatible.arrow_forward
- Suppose you have been directed to find new enzymes to use in the breakdown of wood in order to process biofuel (switchgrass, for example). Suppose you wanted to use fungal or bacterial DNA from the environment in order to do so. DNA can be unwound from the double stranded double helix into single strands, amplified, separated on gels by size, stained with dyes. It can be mutated by a variety of means. It can be sequenced. Describe one or more of the ways that you might manipulate DNA towards the stated goal. Relate the technology you plan to utilize to the structure of DNA. (You can break this into multiple posts, as multiple procedures might be used).arrow_forwardShown below is a portion of a wild-type DNA sequence that encodes the last amino acids of a protein that is 270 amino acids long. The first three bolded base pairs indicate the frame and include the coding region. 5^ ...GCTAAGTATTGCTCAAGATTAGGATGATAAATAACTGG 3^ 3^.. CGATTCATAACGAGTTCTAATCCTACTATTTATTGACC 5^ Which strand is the template strand for transcription of this gene? Briefly explain how you know. An insertion of one base pair causes the protein to decrease in length by seven amino acids. With respect to the sequence given above, where does this insertion occur? A change of one base pair leads to the protein increasing in the length by one amino acid. With respect to the sequence given above, which base pair would you change, and what would you change this base pair for the protein to increase in the length by one amino acid?arrow_forwardWhat observations are consistent with the conclusion that DNA serves as the genetic material in eukaryotes? Select the four correct statements. a. DNA content and ploidy in various cell types( sperm and somatic cells) are related b. DNA is found to be the only macromolecule in eukaryotes that has different subunits. c. Gene transfer is a direct evidence as it has been facilitated by recombinant DNA techniques. d. The correlation of the action and absorption spectra of ultraviolet light support the interpretation that DNA is a genetic material. e. DNA is shown to be present in ribosomes, matrix, and nucleus, where genetic function is performed. f. DNA is shown to be present in mitochondria, chloroplasts, and nucleus, where genetic function is performed.arrow_forward
- Suppose the DNA synthesis that occurs in PCR is less accurate than cellular DNA synthesis (as in, PCR has a higher error rate than normal DNA synthesis). This difference in error would most likely be because the polymerase used in PCR: a) has a low level of 5' to 3' exonuclease activity b)has a low level of 3' to 5' exonuclease activity c) has a low temp at which it denatures d) adds to the 5' end of the growing DNA chain e) does not use templatearrow_forwardWhich of the comparisons between DNA polymerase and RNA polymerase is false? -Both DNA polymerase and RNA polymerase have proofreading activity. -DNA polymerase requires an additional enzyme to unwind double-stranded DNA molecules, but RNA polymerase does not. -Both DNA and RNA polymerase catalyze the addition of nucleotides to the 3’ end. -DNA polymerase needs a free 3’-OH to begin the polymerization reaction, but RNA polymerase does not.arrow_forwardPolymerase Chain Reaction (PCR) was invented by Kary Mullis in 1983. This technique had indeed facilitated research in various areas of molecular biology and genetics. You would like to amplify a particular gene fragment from the yeast genome using Polymerase Chain Reaction (PCR): (i) What is the major enzyme required to kick start this reaction? (ii) Besides the enzymes mentioned in Q2 (a)(), state three (3) other chemicals required for the amplification process to be carried out.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Bacterial Genomics and Metagenomics; Author: Quadram Institute;https://www.youtube.com/watch?v=_6IdVTAFXoU;License: Standard youtube license