Biology 2e
2nd Edition
ISBN: 9781947172517
Author: Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher: OpenStax
expand_more
expand_more
format_list_bulleted
Textbook Question
Chapter 14, Problem 13RQ
Which of the following does the enzyme primase synthesize?
- DNA primer
- RNA primer
- Okazaki fragments
- phosphodiester linkage
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
A DNA strand was sequenced using the Sanger method
(https://www.youtube.com/watch?v=KTstRrDTmWI). The reaction
tube contained the DNA strand, fluorescently labelled
dideoxynucleotide triphosphates (ddATP – yellow, ddGTP – green,
ddCTP – blue, ddTTP - red), deoxynucleotide triphosphates, DNA
polymerase, or its Klenow fragment. Synthesis of DNA is allowed to
proceed, and the results are shown on the right:
15
14
13
12
11
10
(a) What is the sequence of the copy and the template strands?
(b) If the template strand were in the 5'-3' direction, what will be
the sequence of the DNA copy?
Nucleotide Length
Which of the following enzymes can break, and rejoin, phosphodiester bonds during the normal DNA replication process in the chromosomes of E. coli cells?
single-stranded binding proteins
RNA polymerase
topoisomerase
DNA helicase
DNA ligase
Which of the following enzymes is needed to produce mRNA?
ligase
helicase
DNA polymerase
RNA polymerase
Chapter 14 Solutions
Biology 2e
Ch. 14 - Figure 14.10 In eukaryotic cells, DNA and RNA...Ch. 14 - Figure 14.14 You isolate a cell strain in which...Ch. 14 - Figure 14.21 A fr am eshift mutation that results...Ch. 14 - If DNA of a particular species was analyzed and it...Ch. 14 - The experiments by Hershey and Chase helped...Ch. 14 - Bacterial transformation is a major concern in...Ch. 14 - DNA double helix does not have which of the...Ch. 14 - In eukaryotes, what is the DNA wrapped around?...Ch. 14 - Meselson and Stahl's experiments proved that DNA...Ch. 14 - If the sequence of the 5'-3' strand is AATGCTAC,...
Ch. 14 - How did Meselson and Stahl support Watson and...Ch. 14 - Which of the following components is not involved...Ch. 14 - Which of the following does the enzyme primase...Ch. 14 - In which direction does DNA replication take...Ch. 14 - A scientist randomly mutates the DNA of a...Ch. 14 - The ends of the linear chromosomes are maintained...Ch. 14 - Which of the following is not a true statement...Ch. 14 - During proofreading, which of the following...Ch. 14 - The initial mechanism for repairing nucleotide...Ch. 14 - A scientist creates fruit fly larvae with a...Ch. 14 - Explain Griffith's transformation experiments What...Ch. 14 - Why were radioactive sulfur and phosphorous used...Ch. 14 - When Chargaffwas performing his experiments, the...Ch. 14 - Provide a brief summary of the Sanger sequencing...Ch. 14 - Describe the structure and complementary base...Ch. 14 - Prokaryotes have a single circular chromosome...Ch. 14 - How did the scientific community learn that DNA...Ch. 14 - Imagine the Meselson and Stahl experiments had...Ch. 14 - DNA replication is bidirectional and...Ch. 14 - What are Okazaki fragments and how they are...Ch. 14 - If the rate of replication in a particular...Ch. 14 - Explain the events taking place at the replication...Ch. 14 - What is the role of a primer in DNA replication?...Ch. 14 - Quinolone antibiotics treat bacterial infections...Ch. 14 - How do the linear chromosomes in eukaryotes ensure...Ch. 14 - What is the consequence of mutation of a mismatch...Ch. 14 - An adult with a history of tanning has his genome...
Additional Science Textbook Solutions
Find more solutions based on key concepts
If you wish to reduce the stress (which related to centripetal force) on high-speed tires, would you use large-...
College Physics
Write an equation that uses the products of photosynthesis as reactants and the reactants of photosynthesis as ...
Campbell Biology in Focus (2nd Edition)
Your bore cells, muscle cells, and skin cells look different because a. different kinds of genes are present in...
Campbell Essential Biology (7th Edition)
1. Which parts of the skeleton belong to the appendicular skeleton? Which belong to the axial skeleton?
Human Anatomy & Physiology (2nd Edition)
What are the four types of tissues, and what are their characteristics?
Human Anatomy & Physiology
Give at least three examples of key ecosystem services that nature provides for people.
Campbell Biology (10th Edition)
Knowledge Booster
Similar questions
- Which of the following enzymes adds incoming deoxyribonucleotides/deoxyribonucleoside triphosphates to the 3' OH of the growing daughter strand in the 5' - 3' direction? Ligase Polymerase Topoisomerase Primasearrow_forwardWhich of the following enzymes ensures that the correct base of a deoxynucleotide for growing the chain is aligned with template chain? DNA gyrases DNA ligases DNA polymerases primasesarrow_forwardA Sanger product of the sequencing of a template DNA is presented +ddTTP +ddATP +ddCTP +ddGTP Mononucleotide Pentanucleotide Trinucleotide Dinucleotide 11-nucleotide Hexanucleotide Octanucleotide Tetranucleotide 16-nucleotide Decanucleotide Nonanucleotide Heptanucleotide 17-nucleotide 15-nucleotide 13-nucleotide 12-nucleotide 18-nucleotide 20-nucleotide 14-nucleotide 19-nucleotide 21-nucleotide 1. Determine the sequence of template DNA 2. Determine the mRNA sequence from this template DNA 3. Determine the the sequence of protein product derived from that DNAarrow_forward
- The following image shows how DNA can be damaged by UV light. In this reaction, UV light promotes the formation of an cross-link, through the formation of a group, which impact DNA replication and transcription. HN- Thymine HN- UV-B HN- Thymine HNarrow_forwardWhich letter represents the following structures: (0.5X6) Okazaki fragment Replication fork Leading strand Lagging strand DNA template RNA primerarrow_forwardWhich of the following has activity that is most similar to RNA Polymerase? Helicase DNA Polymerase Primase Exonucleasearrow_forward
- Which of the following is true of primers that are used in DNA replication? They are made out of ribonucleotides with a possibility of having a thymidine base. They are made out of ribonucleotides with a possibility of having a uracil base. They are made out of deoxyribonucleotides with a possibility of having a thymine base. They must be made up of proteins.arrow_forwardDNA is made of two strands that are antiparallel. If one strand runs from 3’ to 5’ direction the other one will go from 5’ to 3’ direction. During replication or transcription, whatever the process is, it will always follow the 5’ to 3’ direction using the 3’ to 5’ directed strand as the template strand. Therefore, if following is the DNA sequence 5’-CCG ATC GCA CAA-3’ Using this sequence as template after transcription no protein can be translated. Why? Presence of start codon Absence of start codon Due to mutation If you want to start the translation, what change you need in the second codon (from 5’ to 3’ direction)? Substitution of C with G No change4 Deletion of Both I & IIIarrow_forwardAs you should recall, DNA, when not being actively transcribed, has a double helical structure. This portion of the DNA has had the two strands separated in preparation of transcribing for a needed protein. The following is one of the two complimentary strands of DNA: 3' - AACCAGTGGTATGGTGCGATGATCGATTCGAGGCTAAAATACGGATTCGTACGTAGGCACT - 5' Q: Based on written convention, i.e. the 3'-5' orientation, is this the coding strand or the template strand? ______________________________ Q: Assuming this strand extends from base #1 to #61 (going left to right), interpret the correctly transcribed mRNA and translated polypeptide for bases 24 - 47: mRNA: ___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___- polypeptide chain: ________--________--________--________--________--________--________--________arrow_forward
- What is the polypeptide that will be formed from the following DNA sequence? Template DNA Sequence: 3' T A C T G C G T A G A C C T C 5'arrow_forwardIn the DNA double-helix structure, the larger of the two grooves formed by the helical twist where certain base pairs are exposed is called the:arrow_forwardA segment of a polypeptide chain is Arg-Gly-Ser-Phe-Val-Asp-Arg. It is encoded by the following segment of DNA: G G C T A G C T G C T T C C T T G G G G A C C G A T C G A C G A A G G A A C C C C T Template strand with its polarity: 3’ C C G A T C G A C G A A G G A A C C C C T 5’ - Coding strand with its polarity: 3’ G G C T A G C T G C T T C C T T G G G G A 5’ Please write out the mRNA sequence generated by the template strand to produce that polypeptide chain.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education