Biology 2e
2nd Edition
ISBN: 9781947172517
Author: Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher: OpenStax
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 14, Problem 14RQ
In which direction does
- 5'-3'
- 3'-5‘
- 5‘
- 3’
Expert Solution & Answer
Trending nowThis is a popular solution!
Students have asked these similar questions
5'
3'
For numbers 6 to 10, refer to the image above and answer the questions.
6. Which among the two strands will have a continuous replication?
7. Which is the lagging strand?
8. Along which strand will Okazaki fragments appear?
9. How are Okazaki fragments joined together?
10. Where should the 3' end of the lagging strand be located? On the right or left side?
in
If the sequence of one single strand of DNA is C-A-A-G-T-A-G-G-C-T, what is the sequence of the complementary strand?
Describe the origin of each strand of the new double helices created after DNA replication.
Why is DNA replication important to the growth and development of a multicellular organism?
Place the following terms in the correct order from smallest to largest:
Nucleosome, supercoils, coils, chromosome, DNA double helix
The following DNA sequence is at the start of a DNA strand: 3'—AATTCGAGATTCA—5'. Which of the primer sequences below would be synthesized from this strand by DNA primase to initiate DNA replication?
Group of answer choices
a 3'—TTAACGTCTAAGT—5'
b 3'—UUAAGCUCUAAGU—5'
c 5'—TTAACGTCTAAGT—3'
d 5'—UUAAGCUCUAAGU—3'
Chapter 14 Solutions
Biology 2e
Ch. 14 - Figure 14.10 In eukaryotic cells, DNA and RNA...Ch. 14 - Figure 14.14 You isolate a cell strain in which...Ch. 14 - Figure 14.21 A fr am eshift mutation that results...Ch. 14 - If DNA of a particular species was analyzed and it...Ch. 14 - The experiments by Hershey and Chase helped...Ch. 14 - Bacterial transformation is a major concern in...Ch. 14 - DNA double helix does not have which of the...Ch. 14 - In eukaryotes, what is the DNA wrapped around?...Ch. 14 - Meselson and Stahl's experiments proved that DNA...Ch. 14 - If the sequence of the 5'-3' strand is AATGCTAC,...
Ch. 14 - How did Meselson and Stahl support Watson and...Ch. 14 - Which of the following components is not involved...Ch. 14 - Which of the following does the enzyme primase...Ch. 14 - In which direction does DNA replication take...Ch. 14 - A scientist randomly mutates the DNA of a...Ch. 14 - The ends of the linear chromosomes are maintained...Ch. 14 - Which of the following is not a true statement...Ch. 14 - During proofreading, which of the following...Ch. 14 - The initial mechanism for repairing nucleotide...Ch. 14 - A scientist creates fruit fly larvae with a...Ch. 14 - Explain Griffith's transformation experiments What...Ch. 14 - Why were radioactive sulfur and phosphorous used...Ch. 14 - When Chargaffwas performing his experiments, the...Ch. 14 - Provide a brief summary of the Sanger sequencing...Ch. 14 - Describe the structure and complementary base...Ch. 14 - Prokaryotes have a single circular chromosome...Ch. 14 - How did the scientific community learn that DNA...Ch. 14 - Imagine the Meselson and Stahl experiments had...Ch. 14 - DNA replication is bidirectional and...Ch. 14 - What are Okazaki fragments and how they are...Ch. 14 - If the rate of replication in a particular...Ch. 14 - Explain the events taking place at the replication...Ch. 14 - What is the role of a primer in DNA replication?...Ch. 14 - Quinolone antibiotics treat bacterial infections...Ch. 14 - How do the linear chromosomes in eukaryotes ensure...Ch. 14 - What is the consequence of mutation of a mismatch...Ch. 14 - An adult with a history of tanning has his genome...
Additional Science Textbook Solutions
Find more solutions based on key concepts
4. What five specific threats to biodiversity are described in this chapter? Provide an example of each.
Biology: Life on Earth
Police Captain Jeffers has suffered a myocardial infarction. a. Explain to his (nonmedically oriented) family w...
Human Physiology: An Integrated Approach (7th Edition)
WHAT IF? As a cell begins the process of dividing, its chromosomes become shorter, thicker, and individually vi...
Campbell Biology in Focus
The genes dumpy (dp), clot (cl), and apterous (ap) are linked on chromosome II of Drosophila. In a series of tw...
Concepts of Genetics (12th Edition)
If someone at the other end of a room smokes a cigarette, you may breathe in some smoke. The movement of smoke ...
Campbell Essential Biology with Physiology (5th Edition)
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Which of the following pieces of DNA is going to be easier to separate into single stranded molecules using heat (ie, have a lower melting point), which breaks hydrogen bonds? Why? 1. 5’ ATTTTCCGTAAT 3’ 3’ TAAAAGGCATTA 5’ 2. 5’ ACGGTTTACCGG 3’ 3’ TGCCAAATGGCC 5’ A) 2; it has more C-G pairs which are connected by three hydrogen bonds instead of two, so they are easier to break. B) 1; it has more A-T pairs which are connected by one hydrogen bond instead of two, so they are easier to break. C) 2; it has more C-G pairs which are connected by two hydrogen bonds instead of three, so they are easier to break. D)1; it has more A-T pairs which are connected by two hydrogen bonds instead of three, so they are easier to break.arrow_forwardIf one DNA segment has the following base composition, 5'-CAGTTAGC-3', which of the following sequences is complementary? 5'-GCTAACTG-3' 5'-GTCAATCG-3' 5'-GCTAAGCT-3' 3'-GCTAACTG-5'arrow_forwardThe orginal strand is 5' G-A-C-C-A-T 3' Question: What is the new replicated DNA strand? The ordinal strand is 3' C-T-G-G-T-A 5' Question: What is the new replicated DNA strand?arrow_forward
- Show the replication strands in each of these bubbles (note they have different DNA orientations). Label each end of each DNA strand and include arrows to show which direction it is extending. Show the Okazaki fragments in the correct places. 3' 5'arrow_forwardA region of DNA has six copies of a trinucleotide repeat. During one round of replication, the template strand slips as shown in the diagram. How many repeats will the DNA have if the newly synthesized strand is used as a template in the next round of replication? 1 5'-CAG 3'-GTC GTC 4 2 GTCH 3 2 CAG CAG GTC 3 GTC 5 4 CAG-3' GTC -5' 6 Next round of DNA replicationarrow_forwardIllustrate some steps involved in DNA replication :Suppose the following base sequence was found in a segment of one strand of a DNA molecule: 3’ A-A-T-A-C-C-T-C-C-T-A-A-C-T 5’ What would be the bases in the complementary strand? Label the 3’ and the 5’ ends. Illustrate the DNA molecule below. Label the 3’ and the 5’ ends of both strands. Separate the above DNA molecule up to the seventh base. Add one primer for the leading strand complementary to the first base Adenine of the template strand. Add one primer for the lagging strand complementary to the seventh base Adenine of the template strand. Illustrate the DNA molecule. Label the 3’ and 5’ ends. Elongate the new strands up the seventh base by adding DNA bases complementary to the template strand. Illustrate the resulting DNA molecule. Label the 3’ and the 5’ ends of the template strands and the complementary strands. Elongate the new strands up the seventh base by adding DNA bases complementary to the template strand. Illustrate…arrow_forward
- What is the difference between prokaryotic and eukaryotic DNA replication? in 3-4 sentencearrow_forward.5' 3' For numbers 6 to 10, refer to the image above and answer the questions. 6. Which among the two strands will have a continuous replication? 7. Which is the lagging strand? 8. Along which strand will Okazaki fragments appear?arrow_forwardWhat is the complimentary DNA sequence to the strand below? C-G-G-T-T-A-Garrow_forward
- For the following DNA sequence: 3’–CGATACGGCTATGCCGGCATT–5’ Write: a) the sequence of the complementary DNA strandarrow_forwardDraw the steps of DNA replication. Use the following nucleotide sequence as reference: 5’ C C T A T G C A G T G G C C A T A T T C C A A A G C A T A G C 3’arrow_forwardSupercoiled DNA is more compact than relaxed DNA of the same molecular weight, which gives supercoiled DNA greater elec- trophoretic mobility. Why, then, does positively supercoiled DNA migrate more slowly than relaxed in the experiment depicted in Figurearrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY