Biology 2e
2nd Edition
ISBN: 9781947172517
Author: Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher: OpenStax
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 14, Problem 16RQ
The ends of the linear chromosomes are maintained by
- helicase
- primase
- DNA pol
- telomerase
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Which of the following would be involved in the excision repair of a thymine dimer?
O DNA polymerase I
Nuclease
Topoisomerase
Primase
Explain why telomeres and telomerase are needed for replication of eukaryotic chromosomes but not bacterial chromosomes.
The function of the 5’-> 3’ exonuclease activity is found in which of the following:
Group of answer choices
1 All of the above
2 DNA Polymerase II
3 DNA Polymerase III
4 DNA Polymerase I
Chapter 14 Solutions
Biology 2e
Ch. 14 - Figure 14.10 In eukaryotic cells, DNA and RNA...Ch. 14 - Figure 14.14 You isolate a cell strain in which...Ch. 14 - Figure 14.21 A fr am eshift mutation that results...Ch. 14 - If DNA of a particular species was analyzed and it...Ch. 14 - The experiments by Hershey and Chase helped...Ch. 14 - Bacterial transformation is a major concern in...Ch. 14 - DNA double helix does not have which of the...Ch. 14 - In eukaryotes, what is the DNA wrapped around?...Ch. 14 - Meselson and Stahl's experiments proved that DNA...Ch. 14 - If the sequence of the 5'-3' strand is AATGCTAC,...
Ch. 14 - How did Meselson and Stahl support Watson and...Ch. 14 - Which of the following components is not involved...Ch. 14 - Which of the following does the enzyme primase...Ch. 14 - In which direction does DNA replication take...Ch. 14 - A scientist randomly mutates the DNA of a...Ch. 14 - The ends of the linear chromosomes are maintained...Ch. 14 - Which of the following is not a true statement...Ch. 14 - During proofreading, which of the following...Ch. 14 - The initial mechanism for repairing nucleotide...Ch. 14 - A scientist creates fruit fly larvae with a...Ch. 14 - Explain Griffith's transformation experiments What...Ch. 14 - Why were radioactive sulfur and phosphorous used...Ch. 14 - When Chargaffwas performing his experiments, the...Ch. 14 - Provide a brief summary of the Sanger sequencing...Ch. 14 - Describe the structure and complementary base...Ch. 14 - Prokaryotes have a single circular chromosome...Ch. 14 - How did the scientific community learn that DNA...Ch. 14 - Imagine the Meselson and Stahl experiments had...Ch. 14 - DNA replication is bidirectional and...Ch. 14 - What are Okazaki fragments and how they are...Ch. 14 - If the rate of replication in a particular...Ch. 14 - Explain the events taking place at the replication...Ch. 14 - What is the role of a primer in DNA replication?...Ch. 14 - Quinolone antibiotics treat bacterial infections...Ch. 14 - How do the linear chromosomes in eukaryotes ensure...Ch. 14 - What is the consequence of mutation of a mismatch...Ch. 14 - An adult with a history of tanning has his genome...
Additional Science Textbook Solutions
Find more solutions based on key concepts
Do devices with efficiencies of less than one violate the law of conservation of energy? Explain.
College Physics
Consider two hypothetical recessive autosomal genes a and b, where a heterozygote is testcrossed to a double-ho...
Concepts of Genetics (11th Edition)
Police Captain Jeffers has suffered a myocardial infarction. a. Explain to his (nonmedically oriented) family w...
Human Physiology: An Integrated Approach (8th Edition)
What two body structures contain flexible elastic cartilage?
Anatomy & Physiology (6th Edition)
Meiosis II is similar to mitosis because a. sister chromatids separate. b. homologous chromosomes line up indep...
Study Guide for Campbell Biology
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Considening the structure of DNA, what kind of bonds hold one nucleotide to another within one side of the DNA molecule? O hydrogen O phosophodiester O lonic peptidearrow_forwardDescribe precisely the catalytic activity of DNA polymerase I that removes RNA primers. 3' to 5' exonuclease 5' to 3' exonuclease 5' to 3' endonuclease O 3' to 5' endonucleasearrow_forwardMatch the enzyme on the left with its role in DNA replication DNA polymerase I helicase DNA ligase DNA polymerase III topoisomerase primase 72 W w# 3 E $ 4 R % 5 T A 6 MacBook Pro Y & 7 U * 8 replaces primers with DNA connects Okazaki fragments to form a continuous strand of DNA synthesizes short RNA fragments used to initiate DNA synthesis Uses the 3'OH of an RNA primer to synthesize the leading strand and Okazaki fragments keeps DNA from getting tangled up ahead of the replication fork "unwinds" the DNA double helix at the origin and replication forks 1 ( 9 X 0 0 P + 11 Nextarrow_forward
- Which repair mechanisms is most require to fix thymine dimers? BER NER mismatch repair homologous recombinationarrow_forwardIn each cell if DNA polymerase I is non-functional, how would it affect the leading strandarrow_forwardFor the following DNA sequence along a chromosome answer the following questions: The enzymes are working 5' ATGCATTAGACCACTAGCAT 3' left to right 3' TACGTAATCTGGTGATCGTA 5' 13. On the leading strand only, start with a primer that is 5 nucleotide's long and then finish the rest as DNA polymerase would. Give me the entire strand of only the leading strand.arrow_forward
- A chromosome contains many different genes that are transcribed into different ___ . a. proteins b. polypeptides c. RNAs d. a and barrow_forwardThe function of the 3'-> 5' exonuclease activity is found in which of the following: DNA Polymerase III DNA Polymerase I DNA Polymerase II All of the abovearrow_forwardEscherichia coli's chromosome has a replication origin called OriC. Draw a schematic diagram to show the specific DNA sequences that is essential for replication function scattering over a 245 base pair of Oric region.arrow_forward
- As helicase unwinds the DNA molecule, the separated strands are Topoisomerase kept apart by True Falsearrow_forwardDuring DNA replication, one of the new strands of DNA is synthesized continuously, while the other is synthesized as a number of separate fragments of DNA that are subsequently linked by DNA ligase. This is because O replication starts at many points on the chromosome RNA primers only anneal to one of the parental strands of DNA one of the parental strands is unwound slower than the other by helicase DNA polymerase III only synthesizes DNA in the 5' - 3' directionarrow_forwardExtreme UV exposure leads to the SOS response in bacteria. By what mechanism does the SOS response function? Answer choices induction of photolyase and the addition of white light to remove the thymine dimer destruction of lexA, which leads to expression of an alternate, error-prone DNA polymerase homologous recombination repair non-homologous end joining exinuclease removal of a segment of DNA including a thymine dimer, followed by the replacement of DNA using the complementary strand of DNAarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Biology: The Unity and Diversity of Life (MindTap...BiologyISBN:9781305073951Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa StarrPublisher:Cengage Learning
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Biology: The Unity and Diversity of Life (MindTap...
Biology
ISBN:9781305073951
Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr
Publisher:Cengage Learning
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY