Biology 2e
2nd Edition
ISBN: 9781947172517
Author: Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher: OpenStax
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 14, Problem 26CTQ
Prokaryotes have a single circular chromosome while eukaryotes have linear chromosomes. Describe one advantage and one disadvantage to the eukaryotic genome packaging compared to the prokaryotes.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
A major difference between prokaryotes and eukaryotes is the presence of a nucleus. What advantages and disadvantages may occur with having a cell’s genome packaged in a nucleus?
Describe two main reasons why the proteomes of eukaryotes are usuallymuch larger than their genomes.
Even though the eukaryotic genome is thousands of times larger than the prokaryotic genome, DNA replication times are relatively similar. Explain how this is possible.
Chapter 14 Solutions
Biology 2e
Ch. 14 - Figure 14.10 In eukaryotic cells, DNA and RNA...Ch. 14 - Figure 14.14 You isolate a cell strain in which...Ch. 14 - Figure 14.21 A fr am eshift mutation that results...Ch. 14 - If DNA of a particular species was analyzed and it...Ch. 14 - The experiments by Hershey and Chase helped...Ch. 14 - Bacterial transformation is a major concern in...Ch. 14 - DNA double helix does not have which of the...Ch. 14 - In eukaryotes, what is the DNA wrapped around?...Ch. 14 - Meselson and Stahl's experiments proved that DNA...Ch. 14 - If the sequence of the 5'-3' strand is AATGCTAC,...
Ch. 14 - How did Meselson and Stahl support Watson and...Ch. 14 - Which of the following components is not involved...Ch. 14 - Which of the following does the enzyme primase...Ch. 14 - In which direction does DNA replication take...Ch. 14 - A scientist randomly mutates the DNA of a...Ch. 14 - The ends of the linear chromosomes are maintained...Ch. 14 - Which of the following is not a true statement...Ch. 14 - During proofreading, which of the following...Ch. 14 - The initial mechanism for repairing nucleotide...Ch. 14 - A scientist creates fruit fly larvae with a...Ch. 14 - Explain Griffith's transformation experiments What...Ch. 14 - Why were radioactive sulfur and phosphorous used...Ch. 14 - When Chargaffwas performing his experiments, the...Ch. 14 - Provide a brief summary of the Sanger sequencing...Ch. 14 - Describe the structure and complementary base...Ch. 14 - Prokaryotes have a single circular chromosome...Ch. 14 - How did the scientific community learn that DNA...Ch. 14 - Imagine the Meselson and Stahl experiments had...Ch. 14 - DNA replication is bidirectional and...Ch. 14 - What are Okazaki fragments and how they are...Ch. 14 - If the rate of replication in a particular...Ch. 14 - Explain the events taking place at the replication...Ch. 14 - What is the role of a primer in DNA replication?...Ch. 14 - Quinolone antibiotics treat bacterial infections...Ch. 14 - How do the linear chromosomes in eukaryotes ensure...Ch. 14 - What is the consequence of mutation of a mismatch...Ch. 14 - An adult with a history of tanning has his genome...
Additional Science Textbook Solutions
Find more solutions based on key concepts
In a slap shot, a hockey player accelerates the puck from a velocity of 8.00 m/s to 40.0 m/s in the same direct...
College Physics
The following diagram illustrates passive and active transport across a plasma membrane. Use it to answer quest...
Study Guide for Campbell Biology
21-Year-Old Female with Skeletal Injuries
While riding her bike to campus, 21-year-old Liliana Rose was struck...
Human Anatomy & Physiology (11th Edition)
In shorthorn cattle, coat color may be red, white, or roan. Roan is an intermediate phenotype expressed as a mi...
Concepts of Genetics (12th Edition)
1. ___ Mitosis 2. ___ Meiosis 3. __ Homologous chromosomes 4. __ Crossing over 5. __ Cytokinesis A. Cytoplasmic...
Microbiology with Diseases by Body System (4th Edition)
If someone at the other end of a room smokes a cigarette, you may breathe in some smoke. The movement of smoke ...
Campbell Essential Biology with Physiology (6th Edition)
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- 1)give 3 differences between replication in prokaryotes and replication in Eukaryotes 2)For each item in the following table, decide whether it is related or involved in transcription, translation or replication. 1. Splicing 2. Stop codon 3. Lagging strand 4. RNA polymerase 5. DNA polymerase 6. Telomerase 3) Give the mRNA and the polypeptide (amino acid sequence) that results from the following DNA template strand: DNA template T A C A C G G G C G T A mRNA Amino acid sequencearrow_forwardFor bacteria living in a rapidly changing environment, would a population of bacteria capable of conjugation be more successful than one that could not undergo conjugation? Explain why. Include in your answer a description of the process of conjugation and its advantages over other mechanisms of DNA transfer between prokaryotic organisms.arrow_forwardDuring the process of protein synthesis on a ribosome, when the large ribosomal subunit covalently attaches an amino acid to a growing polypeptide, what is the name of this newly formed covalent bond? the phosphodiester bond the peptide bond the aminoacyl bond the ether bond the glycosidic bond The ability of F+ cells, or Hfr cells, to transfer plasmid DNA to an F- cell is properly called: transversion transformation conjugation transduction transitionarrow_forward
- Shown below is a drawing showing the result of an experiment in which an RNA molecule is allowed to mix with genomic DNA that has been denatured by boiling, and the two molecules are allowed to hybridize. The DNA strand is presumed to be the lighter-shaded one on the top. Note that only one strand of DNA is shown. What type of RNA is this? a eukaryotic mRNA b Any type of Eukaryotic RNA c Any bacterial or Eukaryotic mRNA d Any RNA from any speciesarrow_forwardThe sequences of DNA bases below represent parts of the genes responsible for the production of one type of protein, an enzyme, produced by Botana curus and Species X, Y, and Z Under each DNA sequence, write the complementary messenger RNA base sequences that each of these gene fragments would produce. Note: Unlike during DNA replication, in the production of messenger RNA, the DNA base “A” specifies the RNA base “U.”. Use the universal genetic code table provided (see Universal Code attachment) to translate the messenger RNA base sequences into sequences of amino acids in the protein produced by each species. Write the sequences of amino acids under the messenger RNA sequences.arrow_forwardAs you should recall, DNA, when not being actively transcribed, has a double helical structure. This portion of the DNA has had the two strands separated in preparation of transcribing for a needed protein. The following is one of the two complimentary strands of DNA: 3' - AACCAGTGGTATGGTGCGATGATCGATTCGAGGCTAAAATACGGATTCGTACGTAGGCACT - 5' Q: Based on written convention, i.e. the 3'-5' orientation, is this the coding strand or the template strand? ______________________________ Q: Assuming this strand extends from base #1 to #61 (going left to right), interpret the correctly transcribed mRNA and translated polypeptide for bases 24 - 47: mRNA: ___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___- polypeptide chain: ________--________--________--________--________--________--________--________arrow_forward
- List three ways in which transcription and translation differ in eukaryotes and prokaryotes (Do NOT give me how they differ in replication here)arrow_forwardwhy is it more advantageous for the cell to have its DNA fused to the cell wall as opposed to dispersed freely in the cell?arrow_forwardnon-coding DNAs can be put into two groups, name themarrow_forward
- All are correct about DNA gyrase in E. coli EXCEPT: It works to remove positive supercoiling introduced by the DnaB protein (helicase). It is a topoisomerase that hydrolyzes ATP during its reaction mechanism. Its mechanism involves the breaking of a single phosphoester bond in one strand of dsDNA. It works to relieve supercoiling in DNA to overcome the torsion stress imposed upon unwinding.arrow_forwardIn comparison with prokaryotes, what are some differences in the genome structure of eukaryotic cells that affect how replication takes place?arrow_forwardRestriction endonucleases are bacterial enzymes that cleave duplex (double-stranded) DNA at specific nucleotide sequences. The mode of replication of the animal virus SV40 has been investigated by using restriction endonucleases that cleave SV40 DNA into a number of unique segments. Like most viruses, SV40 DNA is circular. The map positions of the 11 fragments produced by a pair of restriction endonucleases are shown on the next page. Immediately following a 5 or 10 minute pulse of radioactively labeled thymidine, labeled SV40 molecules that have completed replication during the pulse are isolated. These newly replicated DNA molecules are digested by the restriction endonucleases and the resulting fragments are analyzed for the relative amounts of pulse label they contain. The results are in the table below. Assume that at the time the label was added there was a random population of replicating SV40 DNA molecules in all possible stages of synthesis. From the information given below,…arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Biology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning
Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning
Genome Annotation, Sequence Conventions and Reading Frames; Author: Loren Launen;https://www.youtube.com/watch?v=MWvYgGyqVys;License: Standard Youtube License