Biology 2e
2nd Edition
ISBN: 9781947172517
Author: Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher: OpenStax
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 14, Problem 3VCQ
Figure 14.21 A fr am eshift mutation that results in the insertion of three nucleotides is often less deleterious than a mutation that results in the insertion of one
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
A nonsynonymous mutation is also referred to as missense mutation. Which of the following correctly describe
these mutations?
They are permanent and cannot revert or reverse mutate back into a wild-type sequence.
They cause a non-functional amino acid to replace a functional amino acid.
O They result in the insertion or deletion of a small number of nucleotides to the DNA.
They change the nucleotide sequence of a gene but do not change the sequence of the resulting protein.
None of the provided answers are correct.
They convert a codon for a particular amino acid within a gene into a stop codon.
They insert an additional amino acid into the final protein product.
What type of mutation is shown in the diagram?
Why do you think this type of mutation is referred to by this term?
Which type of mutation is most likely to be silent?
An inversion
A deletion
An insertion
OA substitution
Chapter 14 Solutions
Biology 2e
Ch. 14 - Figure 14.10 In eukaryotic cells, DNA and RNA...Ch. 14 - Figure 14.14 You isolate a cell strain in which...Ch. 14 - Figure 14.21 A fr am eshift mutation that results...Ch. 14 - If DNA of a particular species was analyzed and it...Ch. 14 - The experiments by Hershey and Chase helped...Ch. 14 - Bacterial transformation is a major concern in...Ch. 14 - DNA double helix does not have which of the...Ch. 14 - In eukaryotes, what is the DNA wrapped around?...Ch. 14 - Meselson and Stahl's experiments proved that DNA...Ch. 14 - If the sequence of the 5'-3' strand is AATGCTAC,...
Ch. 14 - How did Meselson and Stahl support Watson and...Ch. 14 - Which of the following components is not involved...Ch. 14 - Which of the following does the enzyme primase...Ch. 14 - In which direction does DNA replication take...Ch. 14 - A scientist randomly mutates the DNA of a...Ch. 14 - The ends of the linear chromosomes are maintained...Ch. 14 - Which of the following is not a true statement...Ch. 14 - During proofreading, which of the following...Ch. 14 - The initial mechanism for repairing nucleotide...Ch. 14 - A scientist creates fruit fly larvae with a...Ch. 14 - Explain Griffith's transformation experiments What...Ch. 14 - Why were radioactive sulfur and phosphorous used...Ch. 14 - When Chargaffwas performing his experiments, the...Ch. 14 - Provide a brief summary of the Sanger sequencing...Ch. 14 - Describe the structure and complementary base...Ch. 14 - Prokaryotes have a single circular chromosome...Ch. 14 - How did the scientific community learn that DNA...Ch. 14 - Imagine the Meselson and Stahl experiments had...Ch. 14 - DNA replication is bidirectional and...Ch. 14 - What are Okazaki fragments and how they are...Ch. 14 - If the rate of replication in a particular...Ch. 14 - Explain the events taking place at the replication...Ch. 14 - What is the role of a primer in DNA replication?...Ch. 14 - Quinolone antibiotics treat bacterial infections...Ch. 14 - How do the linear chromosomes in eukaryotes ensure...Ch. 14 - What is the consequence of mutation of a mismatch...Ch. 14 - An adult with a history of tanning has his genome...
Additional Science Textbook Solutions
Find more solutions based on key concepts
Construct Your Own Problem Consider an airplane headed for a runway in a cross wind. Construct a problem in whi...
College Physics
Define histology.
Fundamentals of Anatomy & Physiology (11th Edition)
4. Three groups of nonvascular plants are _______, ______, and _______. Three groups of seedless vascular plant...
Biology: Life on Earth (11th Edition)
Some organizations are starting to envision a sustainable societyone in which each generation inherits sufficie...
Campbell Essential Biology (6th Edition) - standalone book
WHAT IF? As a cell begins the process of dividing, its chromosomes become shorter, thicker, and individually vi...
Campbell Biology in Focus
17. Anthropologists are interested in locating areas in Africa where fossils 4-8 million years old might be fou...
Campbell Biology: Concepts & Connections (8th Edition)
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- A polypeptide has the following amino acid sequence: Met-Ser-Pro-Arg-Leu-Glu-Gly The amino acid sequence of this polypeptide was determined in a series of mutants listed in parts a through e. indicate the type of mutation that occurred in the DNA (single-base substitution, insertion, deletion) and the phenotypic effect of the mutation (nonsense mutation, missense mutation, frameshift, etc.). a. Mutant 5: Met-Ser-Pro-Arg-Leu-Leu-Glu-Glyarrow_forwardA polypeptide has the following amino acid sequence: Met-Ser-Pro-Arg-Leu-Glu-Gly The amino acid sequence of this polypeptide was determined in a series of mutants listed in parts a through e. indicate the type of mutation that occurred in the DNA (single-base substitution, insertion, deletion) and the phenotypic effect of the mutation (nonsense mutation, missense mutation, frameshift, etc.). a. MMutant 4: Met-Ser-Pro-Glu-Glarrow_forwardA polypeptide has the following amino acid sequence: Met-Ser-Pro-Arg-Leu-Glu-Gly The amino acid sequence of this polypeptide was determined in a series of mutants listed in parts a through e. indicate the type of mutation that occurred in the DNA (single-base substitution, insertion, deletion) and the phenotypic effect of the mutation (nonsense mutation, missense mutation, frameshift, etc.). a. Mutant 2: Met-Ser-Proarrow_forward
- A polypeptide has the following amino acid sequence: Met-Ser-Pro-Arg-Leu-Glu-Gly The amino acid sequence of this polypeptide was determined in a series of mutants listed in parts a through e. indicate the type of mutation that occurred in the DNA (single-base substitution, insertion, deletion) and the phenotypic effect of the mutation (nonsense mutation, missense mutation, frameshift, etc.). a. Mutant 1: Met-Ser-Ser-Arg-Leu-Glu-Glyarrow_forwardA polypeptide has the following amino acid sequence: Met-Ser-Pro-Arg-Leu-Glu-Gly The amino acid sequence of this polypeptide was determined in a series of mutants listed in parts a through e. For each mutant, indicate the type of mutation that occurred in the DNA (single-base substitution, insertion, deletion) and the phenotypic effect of the mutation (nonsense mutation, missense mutation, frameshift, etc.). a. Mutant 1: Met-Ser-Ser-Arg-Leu-Glu-Gly b. Mutant 2: Met-Ser-Pro c. Mutant 3: Met-Ser-Pro-Asp-Trp-Arg-Asp-Lys d. Mutant 4: Met-Ser-Pro-Glu-Gly e. Mutant 5: Met-Ser-Pro-Arg-Leu-Leu-Glu-Glyarrow_forwardThe following DNA sequence is derived from the middle of an exon of a eukaryotic gene. This sequence encodes a seven amino acid stretch of a protein. 5' ATGCGGAТАААТТААAАТТСС 3' 3' TACGCCTATTTAATTTTAAGG 5' If the third base pair from the left in the DNA sequence were deleted, what type of mutation would this be called? Second Letter G. UUU UUUC UUA UUG Phe UCU UCC UCA UCG UAU UAC UAA UAG Tyr UGU UGC Stop UGA Stop A Stop UGG Trp G Ser Leu CUU C CUC CUA CUG CCU Leu CCC CCA CCG CAU His CGU CGC Arg CGA CGG Pro САС CAA CAG 1st Gin 3rd letter AUU A AUC AUA AUG ACU le ACC ACA Met ACG AAU AAC AAA AAG AGU AGC AGA AGG Asn Ser U letter Thr Lys Arg GUU G GUC GUA GUG GCU GCC GCA GCG Asp GAU GAC GAA GAG GGU GGC GGA GGG Val Ala Gly Glu nonsense O frameshift O dominant missense UCACD CAGU CAG UCACarrow_forward
- What do you have a nucleotide triplet codes for codon for UGU ? Identify a base pair substitution that would produce a silent mutation at this codon. Identify a base substitution that would result in a missense mutation at this codon. Identify a base pairing substitution that could produce a non-sense mutation add this codon .arrow_forwardGiven the Following DNA template, TAC CGC TCC GCC GTC GAC AAT ACC ACT, write out the cDNA, mRNA, tRNA anticodons, and Give the amino acid sequence. What are the three possible outcomes if a Base Substitution mutation were to occur to the template?arrow_forwardThe name for the kind of point mutation/base substitution when a codon changes from CCC (which codes for proline) to CGC (which codes for arginine) is mutation. 2nd base in codon U CAG Cys Cys STOP STOP Trp Arg Arg Arg Arg Ser Ser Arg Arg Gly Gly Gly Gly Phe U Phe Leu Leu Ser Ser Ser Ser Tyr Tyr STOP Leu Leu Leu Leu Pro Pro Pro Pro His His Gln Gln C Asn Asn lle lle lle Met Thr Thr Thr Thr Ala Ala Ala Ala Lys Lys Asp Asp Glu Glu Val Val Val Val 3rd base in codon DCAGUCAGUCAGUCAG 1st base in codonarrow_forward
- Will an insertion or a deletion of three nucleotides result in a frameshift mutation? Explain why or why not.arrow_forwardBelow is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide sequences:5’ C C T A T G C A G T G G C C A T A T T C C A A A G C A T A G C 3’ 1. If the above DNA strand is the template (antisense) strand and the DNA molecule is transcribed, what is the correct nucleotide sequence and direction of the RNA formed after transcription?arrow_forwardWhich of the following point mutations would properly be defined as a transition mutation? the conversion of adenosine into cytidine the conversion of thymidine into guanosine the conversion of uridine into adenosine the conversion of cytidine into thymidine the conversion of guanosine into uridinearrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Mitochondrial mutations; Author: Useful Genetics;https://www.youtube.com/watch?v=GvgXe-3RJeU;License: CC-BY